The Unz Review • An Alternative Media Selection$
A Collection of Interesting, Important, and Controversial Perspectives Largely Excluded from the American Mainstream Media
 BlogviewRon Unz Archive
Covid and the Political Bankruptcy of the Alternative Media
Email This Page to Someone

 Remember My Information



=>

Bookmark Toggle AllToCAdd to LibraryRemove from Library • B
Show CommentNext New CommentNext New ReplyRead More
ReplyAgree/Disagree/Etc. More... This Commenter This Thread Hide Thread Display All Comments
AgreeDisagreeThanksLOLTroll
These buttons register your public Agreement, Disagreement, Thanks, LOL, or Troll with the selected comment. They are ONLY available to recent, frequent commenters who have saved their Name+Email using the 'Remember My Information' checkbox, and may also ONLY be used three times during any eight hour period.
Ignore Commenter Follow Commenter
Search Text Case Sensitive  Exact Words  Include Comments
List of Bookmarks

Russia’s nuclear arsenal of nearly 6,000 warheads is just as formidable as our own, and its revolutionary hypersonic delivery system far superior. A command by Russian President Vladimir Putin could annihilate the bulk of America’s population in less than an hour.

Under such dangerous circumstances, our need for careful and circumspect behavior towards the other nuclear superpower is obvious, but the reality has been entirely different. With one or two exceptions, we carefully avoided any potentially disastrous confrontation during the 1950s and 1960s height of our old Cold War, but in the recent years and especially the recent months of our renewed conflict, we have done exactly the opposite, now spending many tens of billions of dollars to wage a deadly proxy-war on Russia’s own border. Top media pundits and leading U.S. Senators have publicly called for Putin’s assassination, and our officials have boasted to the press of their successful role in killing numerous Russian generals. Such extraordinarily provocative actions would have been unimaginable under President Ronald Reagan, let alone his more restrained predecessors such as Dwight Eisenhower or Richard Nixon.

Yet oddly enough, while most of our mainstream media routinely castigated and condemned Reagan for his occasionally harsh rhetoric against our Communist Russian adversary, today virtually all of our major media regularly spews forth vastly harsher condemnations of Christian Russia and its leadership. Indeed, these outlets spent four years denouncing President Donald Trump for being insufficiently anti-Russian, sometimes even accusing him of being a Russian puppet. A couple of years ago such extremely irresponsible behavior had led the late Prof. Stephen Cohen of Princeton and New York Universities, an eminent Russia scholar, to declare that the threat of global nuclear war was as great as it had been during the Cuban Missile Crisis of 1963, and we can only imagine what he would be saying today.

But in many respects, the near-total silence of the media on some matters is just as dangerous as their jingoistic anti-Russian rhetoric on others.

Several months ago, the Russian government declared it had obtained hard evidence that a number of Ukrainian biolabs funded by America had spent years producing illegal biological warfare weapons for planned use against Russia. Both Glenn Greenwald and Tucker Carlson noted that the statements made by Undersecretary of State Victoria Nuland in her Congressional Testimony seemed to confirm the reality of these remarkable Russian claims. But virtually every other mainstream Western journalist either ignored this explosive issue or ridiculed the Russian charges.

Then a few weeks ago, Lieutenant-General Igor Kirillov, head of Russia’s Radiation, Chemical, and Biological Defense Forces, held a public briefing at which he expanded on those accusations, suggesting that the Covid virus had been created by America as an illegal bioweapon and deliberately released in an attack. The disease soon spread worldwide, killing some 18 million people, including many hundreds of thousands of Russians and more than a million Americans, while disrupting the lives of many billions. If that Russian charge were substantiated, such an Covid biowarfare attack would rank as one of the most important events in the history of the world, probably only exceeded in significance by the two world wars.

Yet none of those shocking claims by a top Russian general were ever reported in the American media, and when the Russian Foreign Ministry tweeted them out, its account was suspended by Twitter for distributing “false information.” Apparently, our response to extremely disturbing information is to censor it, under the Ostrich-like principle that “what we don’t know can’t hurt us.”

But such total media suppression merely prevents the American public—and American elected officials and policy-makers—from obtaining an accurate knowledge of the world, and this is an extremely dangerous situation. Over the years, I’ve often characterized America as a regime run by its Ministry of Propaganda, and last month I emphasized the importance of dethroning America’s reigning Lords of Illusion.

 

Our elites regard Russia as our bitter international adversary, so perhaps a case could be made that our popular media organs should avoid providing a public platform for that country’s officials, or even covering the presumably self-serving accusations of its top military commanders. But there is another recent example of media silence that is impossible to justify under any circumstances.

For decades, Prof. Jeffrey Sachs of Columbia University has ranked as a pillar of our academic establishment, and in 2020 he was selected to chair our Covid Commission, created to investigate all aspects of the deadly epidemic that had taken so many millions of lives.

But over the last few months, Sachs has courageously repudiated the officially-endorsed Covid narrative and instead unleashed a series of bombshell accusations.

In May, he co-authored an article in the prestigious PNAS journal presenting the strong evidence that the Covid virus had been bioengineered and calling for an independent investigation of its true origins, a dramatic pronouncement ignored by almost all Western media outlets. Since then, he has expanded on that theme with a series of major public statements and interviews, declaring that the virus was apparently the product of American laboratory biotechnology, suggesting a possible connection to our country’s longstanding biowarfare programs, while repeatedly denouncing the orchestrated cover-up of all this important information. At the beginning of July, a short clip of his remarks went super-viral on Twitter, accumulating over a million views.

As the serving chairman of our Covid Commission, it is difficult to imagine any American who can speak with greater authority than Sachs on the origins of the worldwide epidemic that has killed so many millions. In any properly functioning media environment, his recent public statements would have already produced a series of banner headlines in all our major media outlets. Yet instead, scarcely any Western publications have even acknowledged his words.

Although Sachs has not directly endorsed the Russian biowarfare accusations, he does emphasize important facts that seem quite consistent with those explosive charges. Given that reality, the near absolute blackout that the mainstream media has imposed upon his views seems especially reprehensible.

For example, last Monday morning the New York Times carried a major front-page story by Steven Lee Myers, one of the newspaper’s “misinformation specialists,” who denounced and ridiculed the Russian biowarfare accusations, which he explicitly characterized as “falsehoods.” According to the article, the Russian government has declared that America is in violation of the 1975 Biological Weapons Convention and therefore invoked its authority to hold formal hearings in Geneva to present the evidence and allow evaluation of those claims, the first such session in a quarter century. Yet this obviously momentous development was dismissed as self-evidently false propaganda. Early in his piece, Myers stated that “Russia has offered no proof” while failing to note that the Russians had called the hearing so that they could provide exactly such proof to the world’s representatives.

But the most outrageous omission in that lengthy 1,900 word piece was the complete absence of any mention of Jeffrey Sachs or his explosive allegations, although the Russians had repeatedly cited him. The Times obviously feared to inform its readers that American chairman of the Covid Commission was accusing his own government of an ongoing cover-up of the origins of the virus, a position that might seem to lend credibility to the Russian charges.

According to the Times, nearly 4,000 articles have already appeared in the Russian media this year promoting their biowarfare claims. This surely demonstrates the perceived importance of the issue, and many of the more recent pieces have included Sachs’ revelations. So most Russians may now be aware of these important facts, but virtually all American media outlets have totally ignored them, carefully maintaining the ignorance of our own population.

 

Thus, our country is faced with a bizarre and almost unprecedented situation. The Russian government has publicly accused America of creating and deliberately releasing the Covid virus in a biowarfare attack, thereby killing 18 million people around the world including more than a million of our own citizens. And over the last few months, Prof. Jeffrey Sachs, chairman of our own Covid Commission, has confirmed that the virus was bioengineered and denounced an ongoing cover-up of its true origins. Yet virtually all of our major media outlets have maintained a near-absolute silence on those developments, failing to inform any Americans of those bombshell revelations.

These circumstances might seem to provide a perfect opening for the alternative media to play a crucial role, covering the important matters that a compromised mainstream media has so carefully avoided. And such heavy alternative coverage might eventually force mainstream outlets to follow along and report those facts as well, lest they be abandoned as uselessly dishonest by too many of their regular readers.

Unfortunately, with very few exceptions, alternative media outlets have remained just as silent as their mainstream rivals.

Since early 2020, Covid-related issues have become a central focus of alternative media coverage, but the dramatic declarations by Prof. Sachs and the Russian government have attracted only a tiny sliver of interest. Last month, Nathan Robinson interviewed Sachs for his Current Affairs webzine and Robert F. Kennedy Jr. did the same for his podcast, but otherwise the cupboard seems bare.

I’m not even sure that the bombshell biowarfare accusations of the Russian government have received any significant alternative attention outside of Russia’s own RT and Sputnik outlets. It’s quite possible that last week’s front-page Times story ridiculing those Russian charges constituted more coverage than the sum-total previously received over the last few months across the entire alternative media landscape, with the obvious exception of our own website.

What explains the remarkable silence of so many alternative media journalists? I think part of the answer is fear—fear of a story that is so potentially gigantic, fear of being labeled a Russian agent, fear of deplatforming. Some alternative podcasters have explicitly told me this, and I suspect that those concerns are widespread across their community.

A few weeks ago I published a piece arguing that a story may sometimes be just too big for the mainstream media to consider covering, and the same may obviously apply to many elements of the alternative media.

 

However, I think a far larger factor in this pattern of silence is that over the last year or more so much of the alternative media has become totally focused upon an entirely different aspect of the Covid issue, namely the vaccines developed to combat the disease. A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere, probably now encompassing some 15-30% of the American population and almost monopolizing online Covid discourse.

Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly. As an extreme example of this regrettable tendency, a couple of months ago Dr. David Martin, a prominent and influential anti-vaxxer, warned that up to one-third of the American population would soon be dead from vaxxing, and demanded Nuremberg-style tribunals for those responsible for this looming disaster. Political activists or alternative websites can devote only a limited amount of time and space to a given topic, and the anti-vaxxing crusade has absorbed a huge fraction of all Covid-related interest.

My own views on vaccines have always been quite mainstream, and I view the anti-vaxxing movement as a tremendously misguided distraction, so much so that I have speculated it might have been deliberately fostered for exactly that reason. If the most energetic and vocal elements of the alternative media focus overwhelmingly upon vaxxing issues and pay little attention to the virus itself, they are much less likely to cover the dramatic public pronouncements of the Russian government or Prof. Sachs, whose views on vaccines seem as conventional as my own. In a recent piece I discussed the plausible possibility that over the last dozen years, a strategy of “cognitive infiltration” has been used by disinformation operatives to divert the conspiracy-community down blind alleys and away from those issues most threatening to the political establishment. The sudden appearance of the massive anti-vaxxing movement may be a perfect example of this:

There exist some indications of which issues are truly feared by our ruling elites and which are merely considered irritations. Robert F. Kennedy, Jr. is the prominent public figure who leads the moderate wing of the anti-vaxxing movement, and his anti-Fauci book became a #1 Amazon bestseller despite unrelenting media hostility. Over the last couple of years, his Children’s Health Defense website has gotten huge traffic by specializing in articles fiercely condemning the alleged dangers of vaccines. But just one day before he released his recent podcast interview with Prof. Sachs on Covid origins, his website was suddenly banned by both Facebook and Instagram. Apparently, some topics are much more threatening than others.

For whatever combination of reasons, over the last few months alternative outlets have chosen to boycott Prof. Sachs almost as thoroughly as have their mainstream counterparts. If this continues, the alternative media would have revealed itself to be politically bankrupt and useless on a public issue of the greatest global importance, being no better than the New York Times, CNN, or any of the other mainstream media publications they so regularly denounce. I would argue that providing sufficiently strong coverage of Sachs’ dramatic Covid revelations has become the litmus test of credibility within the alternative media community, and so far least, nearly all alternative publications seem to have failed that test.

However, that could easily change. Most journalists, whether mainstream or alternative, take comfort from traveling in herds and reporting on the same stories emphasized by most of their colleagues. So if one or two sufficiently influential alternative outlets begin making Sachs and his statements a leading issue, many other outlets may quickly begin to do the same.

 

I’d like to think that my own analysis of the Covid epidemic might eventually follow a similar trajectory. Since April 2020 I have published a long series of articles arguing that there is strong perhaps even overwhelming evidence that the Covid outbreak was due to an American biowarfare attack against China (and Iran), probably carried out by elements of the Trump Administration but without the President’s knowledge or authorization. Taken together, these articles have been viewed nearly 800,00o times, while also being collected into a freely downloadable eBook and an Amazon print paperback.

Over the last couple of years a fierce debate regarding my Covid hypothesis has raged on the discussion-threads of our own website, encompassing over 18,000 comments totaling more than 2.6 million words. During these lengthy exchanges, I have encountered few strong arguments against this scenario, other than the claim that even rogue elements of the Trump Administration could not have possibly done anything so reckless and foolish, having such disastrous consequences.

But I think the most plausible reason a casual reader might have for disregarding my analysis has been the argument from silence. If my case were actually as strong as I claimed, surely it would not have been totally ignored for so long by virtually every mainstream and alternative journalist in America. Only obviously fatal flaws in logic could explain such a lack of coverage.

However, the utter silence that has similarly greeted the public revelations of Jeffrey Sachs and the accusations of top Russian generals suggests otherwise. If almost every media outlet in the West can ignore the headline-worthy public statements of the chairman of the Covid Commission, it is easy to understand why they would have done the same to my own far more controversial and far less solidly-established analysis.

But I’d like to believe that once there is a major breach in the dam, an enormous flood of long-avoided information will soon flow outward.

Anyone interested in the details of that possible future flood can easily read them in the 60,000 words of my collected articles. And for those who prefer a different format, I presented the material in several interviews earlier this year, which have already established themselves as some of the most popular videos on Rumble. The first video has now been viewed over 430,000 times, and the three together, well over a million.

Kevin Barrett, FFWN • February 16, 2022 • 15m

Video Link

Geopolitics & Empire • February 1, 2022 • 75m

Video Link

Red Ice TV • February 3, 2022 • 130m

Video Link

Related Articles:

 
Hide 482 CommentsLeave a Comment
Commenters to Ignore...to FollowEndorsed Only
Trim Comments?
    []
  1. A command by Russian President Vladimir Putin could annihilate the bulk of America’s population in less than an hour.

    After reading about the reality of our nation, most unz.com readers are indifferent. I’ve had a good run, end it quick.

  2. These circumstances might seem to provide a perfect opening for the alternative media to play a crucial role, covering the important matters that a compromised mainstream media has so carefully avoided. And such heavy alternative coverage might eventually force mainstream outlets to follow along and report those facts as well, lest they be abandoned as uselessly dishonest by too many of their regular readers.

    Unfortunately, with very few exceptions, alternative media outlets have remained just as silent as their mainstream rivals.

    But you appear to be overlooking the possibility that even alternative media outlets might become CIA assets. We know this from Ed Wisner bragging about his Great Wurlitzer, his control of the media and thereby the population. We know this from the German journalist Udo Ulfkotte who confessed to succumbing to CIA pressure to pass on planted stories and implicated journalists everywhere. He paid for that with his life.

    If the CIA can co-opt the mainstream media, it wouldn’t take much to entice alternative media. The alternative media is cash-strapped. The CIA is flush. And the CIA would be highly incentivized to swiftly kill a story of the US government engineering a deadly virus and deliberately unleashing it on the world

  3. Franz says:

    Ron, I’d seriously reconsider vaccines. The wife works at a pharmaceutical business and HAD to get the jab. She has been cursed with a kind of shingles ever since, and we’re talking near to two years. These shots are NOT healthy, locally there are other stories as well. Nothing good.

    Then this:

    …the New York Times carried a major front-page story by Steven Lee Myers, one of the newspaper’s “misinformation specialists”

    Since they’ve stopped printing any worthwhile news, I guess batting down nearly everything — and it will come to that — will be the NYT’s new stock in trade. Expensive litter, the whole MSM.

  4. Anonymous[248] • Disclaimer says:

    Will Ronnie ever admit he was wrong?

  5. jimbojones says: • Website

    Why don’t you do us and yourself a favor, Ron. Go engage the people you are pouring vitriol upon. Go do a public debate with Steve Kirsch or McCullough or Del Bigtree or Mercola and let’s see what you and the public think after that. Those guys are serious and careful about their claims. They are not Alex Jones on his fourth bottle of whiskey for the night or some doctor making wild conjectures.

    Of course we are militant. You took your medicine like a good boy and were lucky enough to suffer no consequences. Millions of others suffered brutal adverse effects, including death. I know a young healthy woman who was in zero danger from Covid whose health has been wrecked forever by the vaccine, as even her doctors admitted. VAERS is full of other reports. Millions of us lost jobs, careers and friends from the mandates. I lost a good job for refusing to be injected with a substance that does not prevent spread and that I know is dangerous that’s supposed to protect me from a sickness to which I am naturally immune and which I got over in two days. I and people like me were treated like lepers and not allowed into museums, bars or universities. I have Canadian friends who were not allowed to board airplanes. In Austria, for a few months they practically expelled the “unvaccinated” from society.

    I and millions of other people like me will never forget this putrid evil and it will be hard to forgive the cowards and fools who permitted it to happen. Of course we are militant. This is personal and this is huge. Unless there is accountability for this crime, the next crime they perpetrate will be worse. Just like Covid was worse than 9/11.

  6. tanabear says:

    Steve Kirsch probably runs the most popular anti-vaxxing site on Substack. However, he does seem to endorse the idea that this was a US bio-engineered virus.

    https://stevekirsch.substack.com/p/how-to-convince-us-we-are-wrong

    Professor Jeff Sachs, the leader of the independent panel tasked with finding the origins of SARS-CoV-2 determined that the virus was likely man-made using technology from US bio-labs. Read this article which has a link to the 1 minute video clip that went viral. That agrees with everything we’ve seen. When that came out, all of a sudden nobody wanted to know anything more. Why the sudden loss of interest in the origin? Why aren’t US labs and the Wuhan Institute of Virology cooperating with investigators if they have nothing to hide? Can we have a public discussion about this? Also, how come Moderna never explained how their 19-nt sequence found its way into SARS-CoV-2? And how did Professor Kristian Andersen determine the virus came from nature just a few days after saying it was man made with NO ADDITIONAL DATA? And why did he delete all his tweets right after Chris Martenson called him out on this? We’re still baffled by all this. We’re sure there is an innocent explanation but Professor Andersen doesn’t want to talk to us about it. It seems he’s camera shy all of a sudden. Why?

    Vaccination safety has taken center stage over the origins of COVID-19 for the simple reason that there were vaccination mandates imposed by the Federal government and many private corporations. If you are mandated to take an experimental vaccine or lose your livelihood, you better believe lots of people are going to view this with far more urgency than the hypothetical origins of COVID-19.

  7. My own views on vaccines have always been quite mainstream, and I view the anti-vaxxing movement as a tremendously misguided distraction, so much so that I have speculated it might have been deliberately fostered for exactly that reason.

    Sorry, but that just isn’t the case. You’ve hyped that idiot Robert Kennedy WAY too many times to justifiably make such a claim.

    Calling the fanatical Kennedy “moderate” works only if he is compared with total lunatics like Dr. David Martin.

    As the serving chairman of our Covid Commission, it is difficult to imagine any American who can speak with greater authority than Sachs on the origins of the worldwide epidemic that has killed so many millions.

    It’s difficult to imagine the motives for this utterly crazy statement. An elderly economist is blowing off on matters he knows nothing about, yet he has been constantly “elevated” here into America’s Best” on the origins of Covid.

    A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere, probably now encompassing some 15-30% of the American population and almost monopolizing online Covid discourse.

    Professional American anti-vaxxers have been around for a very long time, and so have ignorant citizens who comprise their audience. The Internet makes it easy for nuts to get together and do ‘high-fives’ with each other.

    History of Anti-Vaccination Movements

    [MORE]

    https://historyofvaccines.org/vaccines-101/misconceptions-about-vaccines/history-anti-vaccination-movements/

    School Vaccination Wars: The Rise of Anti-Science in the American Anti-Vaccination Societies, 1879–1929
    The second title doesn’t seem to be available online, so I’ll quote a few parts.

    With the increase in vaccination, the number of deaths from smallpox declined, but physicians and parents raised concerns about the procedure’s safety. During an era when the vaccine was not always carefully prepared or properly stored, and needles and arms were not always sterilized, vaccination carried some risks. Moreover, the smallpox vaccine came with adverse effects that ranged from mild to severe. One study found that more than a third of those vaccinated missed some days of work or school because of mild symptoms related to the vaccine. Today, the Centers for Disease Control and Prevention reports that about one person out of every thousand vaccinated against smallpox experienced adverse reactions in the past, including corneal scarring and blindness, disfiguring skin conditions, brain damage, or partial paralysis from encephalomyelitis, and up to around five people per one hundred thousand died. Those with weakened immune systems or certain skin conditions were at greater risk for adverse effects. 9 Parents and physicians on both sides of the Atlantic had doubts about the safety of the vaccine. In England, hundreds of thousands of parents joined anti-vaccinationist organizations after the country passed its first compulsory vaccination statute in 1853. In 1885, English newspapers estimated that between eighty thousand and a hundred thousand people demonstrated against vaccination in Leicester, where they hanged Jenner in effigy. Vaccination riots rocked Montreal, Canada, that same year. In the United States, some of the physicians who became leaders of local and national anti-vaccination societies had seen their patients become ill or die after being vaccinated. 10

    Vaccination has always been somewhat hazardous, and there are always ambitious/unethical people willing to exaggerate the risks while minimizing the benefits. I’ve seen articles telling how the 1918 Flu Pandemic adversely affected some of the survivors for the rest of their lives. The same thing is going to be true for COVID.

    In the 1880s, many homeopaths opposed to vaccination still did not accept the germ theory of disease. Before the acceptance of this theory between 1870 and 1900, physicians, scientists, and health officials explained the incidence and spread of illness without any awareness of the microorganisms that caused disease. In 1850, three main theories predominated: The miasma theory stated that disease was caused by poor climate or bad air or wind. The filth theory stated that unclean living quarters containing decaying matter or feces caused disease. The germ theory stated that miniscule organisms invaded the body and that a specific microorganism, or germ, was responsible for a specific disease. Louis Pasteur first confirmed the germ theory in 1860, and by 1895 most American doctors, including many homeopaths, had come to accept it. This shift reflected the swift pace of discovery in medical science. In 1882, Robert Koch discovered the bacillus that caused tuberculosis and then isolated the cholera bacillus. In 1884, Friedrich Loeffler isolated the diphtheria bacillus and Arthur Nicolaier discovered the toxins that caused tetanus; in 1885, Pasteur successfully vaccinated a boy against rabies. Despite these breakthroughs, some of the homeopathic physicians who remained active in the AVSA refused to accept the germ theory well into the twentieth century. 23

    One hundred and forty years later this looks sort of loopy, but consider how many people at this site deny COVID even exists.

    One final point: Mr. Unz continues to offer a platform to similar denials of reality. Starting with White Skin makes a person Homo Superior.

  8. “…and in 2020 he was selected to chair our Covid Commission, created to investigate all aspects of the deadly epidemic that had taken so many millions of lives.”

    Wow.

    Why simply drink the Kool-Aid when you can straight up shower in it.

    The plague was fake but the bioweapon masquerading as a vaccine is very real. You have failed two of the most important worldwide IQ tests in history.

    To defend these lies even at this late date as the hidden facts are revealed leaves one with serious questions about you, Ron.

    • Agree: allergic2katz, Weave
    • Replies: @H. L. M
  9. Bioweapon says: • Website

    No the Pentagon did not make it happen on purpose (MIHOP) ; they’re idiots.

    But it could have been funded conveniently through some DOD contract in Ukraine. Assign someone to go over the contracts and personnel in those labs, e.g. ‘local funding agencies’. Think Paul Singer, Roger Hertog , the Tikvah fund, closely aligned with Neuland et alia. Kristol is on the board of this local funding agency.agency

    The bioterrorism threat and dual-use biotechnological research: An Israeli perspective

    Local funding agencies also play their part. For example, the Israel Science Foundation (ISF), Israel’s largest and most important source of biomedical research funding, requires that grant applications be endorsed by the recipient institution and by its Helsinki Committee (for experiments involving human subjects) or by its Institutional Committee for Animal Experimentation (for animal experiments) or other relevant bodies. For example, work with genetically engineered plants must be approved by the National Committee for Transgenic Plants (NCTP). At present, the ISF itself does not require institutional certification of either biosafety or biosecurity.

    link

  10. While media distraction, censorship and misinformation etc play the cognitive warfare game… there may be some basic reality in the examination of reactions and behind the scenes estimates.

    For example… the ‘injections’ may in reality be about the expectation of biowarfare retaliation and thus shining light upon the deliberateness of the COVID Coronavirus creation and biowarfare use.

    This would also tend to the review of who knew in advance of a release and who was making preparations knowing that blowback and retaliation were likely. It is the arsonist that is most clairvoyant as to future fires.

    The previous virus occurrences upon the poultry and pork industries in China add more weight to the deliberateness and economic targeting with these low level bioweapons.

    An immediate further occurrence of the virus in Qom, Iran becomes even more illustrative of a deliberateness of action. Especially with the assassination of Soleimani outside Iran notable in that as a target he was not apparently susceptible to the Qom attack whether Qom was infected from China or another attack had occurred there.

    We are also being killed by the hail storm of the money connection to the people foremost in the lab and contract biowarfare world. The number of U.S. biowarfare labs is an indicator in itself as to ultimate creation and usage likely of these weapons.

    And strangely an immense hostility against Stromectol aka Ivermectin which has been listed in a Physicians Desk Reference for human use for at least 25 years. It has proven to be a very effective anti-viral agent in reducing the viral load of this coronavirus and its variants bringing about vast numbers of persons recovering from COVID.

    And so motive. Why be so estranged against Stromectol/Ivermectin which is known to be a huge effective treatment against viruses? Money… designing an injection regime for expected biowarfare retaliation… the projected use of another bioweapon and ‘variants’ yet unseen etc etc?

    In’connect the dots’ world there are way too many already established facts (far beyond those mentioned here) that show a subset of other facts. Thus the cognitive warfare games and immunity claims up front.

  11. Yet another Matryoshka Troll, and straight to the pejorative broad-brushing:

    Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant

    […]

    a strategy of “cognitive infiltration” has been used by disinformation operatives to divert the conspiracy-community down blind alleys and away from those issues most threatening to the political establishment. The sudden appearance of the massive anti-vaxxing movement may be a perfect example of this.

    No, sir. I — and likely many others here who’ve foregone the shots — really do appreciate your work on provenance. But while you used to threaten to “trash anti-vaxx nonsense” from comment threads, now you bait them. You’ve become your own “cognitive infiltrator,” Mr. Unz.

    Well, as long as we’re tightening this script, I’ll jump ahead, too:

    1) Which shot(s) have you had, and when?

    2) How many more do you intend?

    • Agree: TheMoon
    • Replies: @Skeptikal
    , @Espace
  12. Nancy says:

    Hmmm…. the timing of this recent about-face by some semi-MSM types on the origins of the C19 virus (from natural origin to lab origin) smacks of red-herring timing.

    Seems to me that the whole point of the virus was the vax, which was pushed out by changing vaccine definitions, ignoring early treatment success that would have invalidated the desperately desired EUA authorization, a horrific fear porn campaign for a 99.6 % survival rate, flagrant misinformation re: actual research (i.e., Surgisphere et al), misuse of a PCR test that CDC has now admitted couldn’t tell the flu from the C19, illegal ‘mandates’ (the tennis champ couldn’t be allowed in but thousands came across our southern borders untested), and on and on and on.

    So they got what ‘they’ wanted – the jab in almost every arm in the West (note, not so much in the 3rd world… it’s the 1st world they aimed at). And now the results of the ‘vax’ rollout are surfacing… SADS (Suddent Adult Death Syndrome), record-setting morbidity numbers from insurance stats, alarming mortuary reports, damaged immune/cardio/neuro/reproductive systems, etc, etc, etc.

    And as these results are appearing and accumulating, we now have the handwaving about the origins of the virus. (Not to mention the fortuitous Ukraine instigation of the Russian SMO.) I repeat… red herring or cognitive infiltration, much? And alt media may consider the apparent depopulation effort more important…. it can possibly be mitigate now, in real time.

    (Besides, I found Jeffrey Sachs disgusting when he served the Russian oligarchs in the 90’s, and I have no reason to believe he’s changed masters …. anyone have a reason?)

    • Agree: Mehen
    • Replies: @Skeptikal
  13. Your proposal that the anti-vax movement could be a deliberate deflection from investigations of covid origins and purpose, recalls the incessant JFK assassination discussion over the shooting itself rather than what happened at the Bethedsa autopsy, or similarly the 9/11 attack focus on the twin towers to distract from discussion of WTC7 or the physics of the other 2 alleged crashes.

    • Agree: Bro43rd
    • Replies: @Kevin Barrett
  14. “Only”obviously,fatal flaws in logic could explain such a lack of coverage”?

    That’s classic,and right on target.But,what if there’s more “onlys’ “to it?

    Knowingly,intentional “gain of function” regarding these “fatal flaws”

    would reveal a totally different sort of “logic”,would it not?”Semi logic”?

    Buck Fiden’s slogan is “we don’t want to make America great again.”

    Perhaps this “long avoided future flood of information” could be

    clarified with a more precise form of semi language? Thanks.

  15. meamjojo says:

    Several months ago, the Russian government declared it had obtained hard evidence that a number of Ukrainian biolabs funded by America had spent years producing illegal biological warfare weapons for planned use against Russia. Both Glenn Greenwald and Tucker Carlson noted that the statements made by Undersecretary of State Victoria Nuland in her Congressional Testimony seemed to confirm the reality of these remarkable Russian claims. But virtually every other mainstream Western journalist either ignored this explosive issue or ridiculed the Russian charges.

    NYT disagrees with you. As do I.

    Russia’s Unfounded Claims of Secret U.S. Bioweapons Linger On and On
    Without providing evidence, the Kremlin is pressing allegations that the U.S. operates labs in Ukraine and beyond. This week, it has called an investigative session in Geneva.

    By Steven Lee Myers
    Sept. 4, 2022

    The United States secretly manufactured biological weapons in Ukraine. It trained birds to carry pathogens into Russia. It created Covid-19. It operated laboratories in Nigeria that engineered this year’s outbreak of monkeypox.

    Of the many falsehoods that the Kremlin has spread since the war in Ukraine began more than six months ago, some of the most outlandish and yet enduring have been those accusing the United States of operating clandestine biological research programs to wreak havoc around the globe.

    The United States and others have dismissed the accusations as preposterous, and Russia has offered no proof. Yet the claims continue to circulate. Backed at times by China’s diplomats and state media, they have ebbed and flowed in international news reports, fueling conspiracy theories that linger online.

    In Geneva this week, Russia has commanded an international forum to air its unsupported assertions again. The Biological Weapons Convention, the international treaty that since 1975 has barred the development and use of weapons made of biological toxins or pathogens, gives member nations the authority to request a formal hearing of violations, and Russia has invoked the first one in a quarter-century.
    ….
    https://www.nytimes.com/2022/09/04/technology/russia-bioweapons-geneva.html

  16. Mikael_ says:

    Just the theory that the “vaccines” might be dangerous, is a strategy of “cognitive infiltration”!!

    “Stop, you’re making it worse!” /Monster Inc

  17. leclerc says:

    Too many in the “alternative” media are either shills or idiots; often both. This site is no exception.

    Obvious psyop is obvious.

    • Troll: RoatanBill
  18. Aww, bioengineered, schmioengineered! There is no virus. Wake-up!!

    • Replies: @Nancy
  19. IreneAthena says: • Website

    … to declare that the threat of global nuclear war was as great as it had been during the Cuban Missile Crisis of 1963, and we can only imagine what he would be saying today. – Ron Unz

    He might recommend that the metric of the global nuclear count-down clock be changed from “minutes ‘til midnight” to microseconds. No wonder there’s so much interest lately in the theory that time is just an illusion: According to science, we’ve got all the time in the world…

    But over the last few months, Sachs has courageously repudiated the officially-endorsed Covid narrative and instead unleashed a series of bombshell accusations. – Ron Unz

    …and speaking of time…it’s about dang time.

    A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere…

    Almost nowhere? I wonder where that is: “…almost nowhere, West Virginia, Blue Ridge Mountain, Shenandoah River?”

    Militant? Not unless you call “beating your clot-shot syringes into ploughshares” militant. Away with these baseless and Biden-esque accusations of militancy!

    Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant. – R.U. ibid

    How annoying is that, when someone only accepts half of a perfectly synthesized whole??? Don’t buy the antidote from the crook who poisoned you in the first place.

    • Agree: Weave
  20. skrik says:

    There’s an ‘old’ saying:

    the truth will out

    My response: Possibly, but not if some covert, criminal cabal wishes to prevent the truth being aired. Examples:

    1. 9/11

    2. SARS-CoV-2

    3. Ukrainian proxy-war against Russia

    Each of these has an undisputable truth which ‘puts the lie’ to what we term ‘the pushed-paradigm narrative.’

    [Aside: ‘Neoliberal economics’ as erring ideology would be another item on the above list, although a) it holds no undisputable truth but b) it could be debunked by a proper, honest analysis – sadly missing in both academic and ‘layman’ – err, oops: ‘layperson’ circles.]

    Now, each country has ‘secret services’ whose precise function is to know ‘everything.’ But unfortunately, what they set out to hide mostly stays hidden, and so the ZUSA mighty Wurlitzer is ‘free’ to spread what we may re-term as ‘the pushed-paradigm filthy, lying propaganda narrative.’

    ‘Enforcers’ of the pushed-paradigm in here are often termed trolls. rgds

  21. A million American deaths? Based on what? The very institutions that lied about and shape-shifted the narrative from day one? Even in Texas it was found that the numbers for purported Covid “cases” were wildly over counted. These false numbers were then used as an excuse to hammer everyone with unnecessary mandates…. freedom be damned! The resultant and ongoing deaths and injuries from the fearful and sheepish populace is the slow motion tragedy unfolding before our very eyes. What I suspect will happen next will be another false crisis put into play in order to cover up this ongoing murder.

    • Agree: H. L. M
    • Thanks: Weave
  22. @meamjojo

    NYT? Such a fount of objective truth.

    /s

    • Replies: @meamjojo
  23. Wild Man says:

    On this passage of the article:

    “Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly.”

    Wrong. The vaxxo-shite-hesitant, (aka the western experimental so-called-vaxx hesitant, aka the western experimental gene-therapy-hesitant), …. which includes me and a whole bunch of my fellow commentariat here at UR, tend to believe that the evidence for the origins of sars-cov-2 as a lab creation, is very very good (at least that has been the case since I have been commenting here in earnest since about April/21), and taking that evidence, together with the massive massive astounding amount of evidence around the huge series of lies that were presented to the general public by Covid Officialdom, since the beginning of the pandemic, with said lies taken as a set, indicating the deceit was orchestrated to forcefully coerce, as many people as possible, to accept the inoculations, …. has led many of us vaxxo-shite-hesitant, long before the roll-out of the vaxxes, to conclude that the release of this lab-engineered pathogen, sars-cov-2, is being used to force this not-effective, not-safe, paradoxical vaxx program, …. rendering sars-cov-2 a bioweapon of sorts. However, we do not yet know why any of his was done and continues to be done. Me and my fellow vaxxo-shite-hesitant have many conjectures about that, …. but we all realize, at this juncture, these are still just conjectures.

    [MORE]

    Also, Unz is wrong to the point I think he may indeed be lying, on the hyperbole, when he claims: “while they believe that the vaccines are enormously deadly” … the vaxxo-shite-hesitant tend not to believe that the vaccines are enormously deadly in the short-term, only ‘not-safe’, but that there is still plenty to be concerned about, as to what the longer-term scenario, vaxxo-harm-wise, will look like. Also note that this ‘not-safe’ claim of the vaxxo-shite-hesitant, has been vindicated, and indeed fuel for even greater concern, has now been eventuated by recent excess-all-cause mortality paradoxes.

    So the truth is, here at this site, the vaxxo-shite-hesitant have been allies of Unz’s, in his quest for seeing deeper into, why in heaven’s name, our perceived ‘sars-cov-2 rendered as bioweapon of sorts’ condition, has come to be (because, as I said, the vaxxo-shite-hesitant crowd tend to clearly see that, beyond the evidentiary signals of concerted, and therefore agenda-driven, deceit, we are still dealing with conjectures, all round, with respect to the ‘whys’). But Mr. Unz refuses to consider this potential ally-ship (but we don’t …. the vaxxo-shite-hesitant here, continue to consider this potential ally-ship, even after having been heavily and unfairly scorned by Unz for well over a year). Mr. Unz scorns this potential ally-ship (even though we don’t scorn him) because he refuses to even consider the huge evidentiary signals of concerted, and therefore agenda-driven, deceit, as practiced by Covid Officialdom, ….. lies that were presented to the general public, since the beginning of the pandemic, with said lies taken as a set, indicating the deceit was orchestrated to forcefully coerce, as many people as possible, to accept the inoculations. The Unz stance, demeanor, misplaced hyperbole, and general deceitfulness in this vein continues to be weird. Very weird.

    On this passage of the article:

    “As an extreme example of this regrettable tendency, a couple of months ago Dr. David Martin, a prominent and influential anti-vaxxer, warned that up to one-third of the American population would soon be dead from vaxxing, and demanded Nuremberg-style tribunals for those responsible for this looming disaster.”

    Hey, …. I got a novel concept, …. how about Unz taking Sachs insinuations (from the Kennedy interview), that the extended Baric-family of GOF-virologists, may have thought they were increasing the infectivity, furin-cleavage-site-insert-wise, of a pathogen of potentially 10% IFR, …. and extrapolate that upon Martin’s actual claims in that interview (he was claiming that the tangle of the government’s own documentations, patent-wise and so forth, indicated a 10% global kill-off, – higher in the U.S.). I too believe that is a crazy claim. But perhaps less crazy after considering Sachs insinuations. Martin did not specifically say this documentation advised this was solely by way of vaxx. He was insinuating the whole thing together: bioweaponized virus + bogus vaxx. I agree that Martin comes off poorly in that particular interview, as I have already said (but I also recommend that anybody quoting Martin for some effect, like Unz, should first actually find out what Martin’s precise claims actually are, because the interviewer was a big zero with respect to prompting clarifications). But Unz should not be in the business of misrepresenting the actual claims of the references he links. Unz has been caught out several times now, doing just that, and this Martin business, is another example.

    On this passage of the article:

    “For whatever combination of reasons, over the last few months alternative outlets have chosen to boycott Prof. Sachs almost as thoroughly as have their mainstream counterparts.”

    No, this is not even close the being true. I have made links to Unz of alternative sources carrying the Sachs claims, as have many other commenters, here. And, as well, Unz’s claims with respect to the lack of alternative coverage and mention of the Russian claims against Ukraine biolabs, is also a bogus claim (but of course, true for both claims, with respect to MSM coverage).

    On this passage of the article:

    “If this continues, the alternative media would have revealed itself to be politically bankrupt and useless on a public issue of the greatest global importance, being no better than the New York Times, CNN, or any of the other mainstream media publications they so regularly denounce. I would argue that providing sufficiently strong coverage of Sachs’ dramatic Covid revelations has become the litmus test of credibility within the alternative media community, and so far least, nearly all alternative publications seem to have failed that test.”

    Wrong as pointed out in the passage just above. Alternative media is very flawed in a number of ways, but as well, much much better than MSM on the issues Unz is pointing out. As well, I don’t see how Unz can claim that ‘believe-Sachs’ is a litmus test, when, I for one, don’t know if Sachs sees this vaxxo-shite program in the same insane terms as Mr. Unz, or not. Also, was Sachs one of those nuts widely recommending masking? These issues, tend to be litmus tests, for some other parties (like me). If Unz wants these other parties to take Sachs with complete seriousness, it would be nice to know how much of a wonk Sachs may otherwise be, on all these other Covid Officialdom lies.

    On this passage of the article:

    “But I think the most plausible reason a casual reader might have for disregarding my analysis has been the argument from silence. If my case were actually as strong as I claimed, surely it would not have been totally ignored for so long by virtually every mainstream and alternative journalist in America. Only obviously fatal flaws in logic could explain such a lack of coverage.”

    OMG. That is not it at all. Unz’s particular bioweapon theory is being widely ignored by alternative media because it is completely dependent on several different threads of circumstantial, and thus somewhat suspect, evidence (as commenters have never ceaselessly stopped pointing out to Unz). Of course, that is why alternative media tends to ignore it. But MSM media censors pretty much anything against the official narrative.

    On this passage of the article:

    “However, the utter silence that has similarly greeted the public revelations of Jeffrey Sachs and the accusations of top Russian generals suggests otherwise. If almost every media outlet in the West can ignore the headline-worthy public statements of the chairman of the Covid Commission, it is easy to understand why they would have done the same to my own far more controversial and far less solidly-established analysis.”

    Hahahaha! Too funny. Unz is conflating the signals of the MSM/alternative-media ignoring of his highly speculative theory with the MSM ignoring of Sachs highly-probable claims. No … Unz is not in the same boat with Sachs, claims-worthiness-wise, the way he suggests.

    This article should be redrafted to repair these glaring errors. Otherwise, I suppose we take it for agitprop of some kind. Unz is about to lose the only allies he has within his endeavor to explore the ‘sars-cov-2 as bioweapon’ angle. And these allies are the vaxxo-shite-hesitant crowd, who want resolution of their own theory, that the release of this lab-engineered pathogen, sars-cov-2, is being used to force this not-effective, not-safe, paradoxical vaxx program, …. rendering sars-cov-2 a bioweapon of sorts.

    It is nuts now, for anyone to conclude (as Unz still does) that the vaxxo-shite program, can be realistically deemed anything better than a big zero at the very best, or most probably somewhere along the gradient of ‘a fairly substantial negative’ and ‘a massive negative’. but Unz still thinks, that on balance, that the vaxxo-shite program saves lives. Hahahaha! What the heck?

    • Thanks: Skeptikal
  24. A123 says: • Website

    Any investigation is easy to call for.

    However, one would be excruciatingly hard to execute. Especially for Alternative media with minimal resources.
    ___________________________________

    MOTIVATION

    All motivations need to be on the table. Here are some options:

    [MORE]

        -1- Rogue Necons
        -2- Rogue Leftoids
        -3- Rogue CCP officials
        -4- Local criminals
        -5- Global criminals
        -6- Eco Extremists
        -7- ???
    This list probably needs expansion.

    1. While Mr. Unz is exclusively locked in on the first. It is actually the least likely alternative. Those currently in the White House would have no reason to undermine Trump’s re-election bid. They would have waited until after the election to launch their conspiracy.

    2. The timing is much more consistent with an an intentional release having #NeverTrump motivations. Anti-American Leftoids were (and still are) mouth frothingly deranged over MAGA’s triumphs. Insane hatred of America and the willingness to burn the world to get Trump is cult mentality in action.

    3. Trump’s successful implementation of the United States-Mexico-Canada Agreement [USMCA] was a brutal shock to the most expansionist factions within the CCP. They would be incredibly desperate, and thus bigly motivated, to prevent a 2nd Trump term that would further limit their personal ambitions.

    4. Theft of animals or equipment from WIV could easily create the “Patient Zero” event in part of Wuhan away from the laboratory. WIV as Origin with “Patient Zero” at the Wet Market is highly plausible based on experimental animals being stolen & sold.

    5. BigPharma is an obvious suspect for Global crimes. How much money was made off the emergency mRNA vaxx? However, the pandemic also damaged their international supply chains.

    6. There are nutters who want to cull the human population to under a billion people.
    ___________________________________

    INVESTIGATION

    There are some key structural problems any investigation must overcome to be fair and credible. All of these issues seem rather impenetrable.
    ___

    Access — The investigation must consider all of the possible of sources:

    Will Xi and his CCP agree to a complete investigation of his country’s laboratories, notably the Wuhan Institute of Virology [WIV]?

    If not, why should any other country allow access that the CCP will not grant?
    ___

    Timing — With multiple years to clean up facilities, does any evidence still exist? Worse yet, with multiple years of advance warning how much “evidence” has been fabricated?

    If a copy of the elusive DIA/NCMI document became public now, how would anyone verify its authenticity? The story surrounding its release to at least 31 nations (NATO + Israel) would makes its highly convenient appearance over 10 months later seem quite dubious to smart, honest observers.
    ___

    Composition — How will the investigators be selected? And, by whom?

    Prior WHO efforts have been contaminated by politics. Does anyone on any side accept them as credibile?

    The UN is a laughable and untrusted institution. Anything they attempted to foist on the public would be doomed before the first day of inquiry.

    A joint PRC/USA body perhaps? Hunter Biden has personal financial connections to CCP officials. This also seems like a doomed concept.
    ___

    While a fair investigation is desirable & sounds good, it is hard to see how one could actually be conducted.

    PEACE 😇

    • Replies: @Wizard of Oz
  25. What about all those people in good health who took the vaccine and the boosters then caught Covid-19 and died of it? Some vaccine that?!

    • Replies: @Wizard of Oz
  26. But there is another recent example of media silence that is impossible to justify under any circumstances.

    As Dr. Freud (in the footsteps of Arthur Schopenhauer and – – – Johann Wolfgang von Goethe) showed time and time again, the human mind can justify right away everything. The greater miracle are those instants in which we see things as they are.

    • Agree: JimDandy
  27. JM says:
    @Zachary Smith

    Here, by concentrating on an extreme wing of the anti-RNA vaxx movement (not Senator Kennedy), you have created a straw man.

    BTW, from which branch of Big Pharma do you draw your pay/remuneration?

    • Agree: AlexanderEngUK
  28. Bro43rd says:
    @Zachary Smith

    Do you ever tire of shilling for the status quo? TUR needs a “status quo government troll” button.

    • Agree: AlexanderEngUK
  29. Hegar says:

    For decades, Prof. Jeffrey Sachs of Columbia University has ranked as a pillar of our academic establishment, and in 2020 he was selected to chair our Covid Commission, created to investigate all aspects of the deadly epidemic that had taken so many millions of lives.

    Wow, that sounds so official! So the world is just like a Bond movie after all, or that Stephen King movie The Last Stand!

    Except “our Covid Commission” is actually just the magazine The Lancet emailing some people and asking them to call themselves a “commission”.

    But the idiots who want to believe “COMMUNIST CHINA CREATED THE VIRUS IN A LAB AND IT ESCAPED” hate hearing facts. They prefer the lies told by Cucker Carlson in this matter. They completely ignore the fact that the virus is SARS 2 and came from the Wuhan exotic-animals “wet market” just like SARS 1 and other diseases before it, where SARS 2 was found in plenty of blood samples, after all the first SARS 2 patients had visited the market.

    No no no, must not blame the people of Wuhan, that’s racist. Instead the cucks want a fight against “communism” even though China is a conservative and nationalist market economy today, far, far more so than the U.S. Which is why the cucks find it a safe target. Unlike, say, the socialist regime in South Africa.

    Plus! This way we can blame Fauci, and that way the Democrats! Because he was part of funding perfectly normal research at the virus lab in Wuhan, back when the world was more normal and you could actually cooperate on scientific projects across borders without being labeled a traitor. Did you hear that guys, we can pin it on the DEMOCRATS! Never mind that it was Trump who approved of the research.

    So Cucker Carlson peddles lies like saying the Wuhan virus lab is close to the wet market, even though it’s far away and on the other side of a wide river. And that “two people got sick at the lab!” Um, yeah. Good catch, kid. Or that “one researcher threw up in the lab!” Carlson lies, that guy threw up years ago and it was in a forest. Or “they had to cancel a party!” Another lie, that never happened, and even if it did, stop acting like a lying rat trying to find “evidence” where there is none.

    Cuckservatives then list “experts” as if what they said was proof. Never mind what thousands of other experts say around the world. This is exactly the way the Democrats ran the Russia hoax. “It MUST be true, because this pundit on my teevee says it, and EVERYONE says it! Look at all these STATEMENTS!”

    Then again, if GOP voters weren’t as dumb as Democrat voters we wouldn’t be here today.

    Of course GOP voters can never stop and think of why their “DEMOCRATS/FAUCI AND THE COMMUNIST PARTY CREATED THE VIRUS!” claim is only believed by them, no one else in the world. Even though their fantasy relies so heavily on “look what all these people say!” in place of actual facts. When asked about this, they’ll simply pull out their usual hostility toward the rest of the world, so convenient for shutting down an issue when needed.

    • LOL: Legba
    • Troll: AlexanderEngUK
  30. The “alternative” media has always been the mainstream media rebranded.

    CIA writers were featured in just about every “alternative” publication from the 60s to the 90s: Playboy, Penthouse, Rolling Stone, Ramparts.

    Playboy banked with CIA and nearly HALF of the writers named on the cover were CIA funded. Andrea Nolen called Playboy “the American Pravda.”

    • Agree: Weave
    • Thanks: Commentator Mike
  31. Emslander says:

    You’re getting there, Mr. Unz., but it’s awfully slow.

    I think I outlined this biolabs scenario for you back in May or June, but you said I was stupid and a victim of anti-Fauci propaganda. Please note that the biolabs are under the direction of one Dr. Anthony Fauci.

  32. Skeptikal says:

    IMO Ron Unz himself bears a large portion of the blame for the supposed creation of a huge “anti-vaxx” movement because he persists in trolling sceptics of specifically the corona jabs as “anti-vaxxers.”

    This has been pointed out repeatedly at this site—to the extent that he himself has often been accused of being a limited hangout type of guy, pushing the “anti-vaxx” line to avoid a crackdown on his own site.

    Unz’s trolling of corona-jab sceptics as “anti-vaxxers” has consumed a hell of a lot of oxygen and energy that should have been directed toward more constructive debate.

    To be sure, he himself investigated and presented his views on the origins of the virus as a bioweapon.

    But his trolling of his actual readers with the continual “anti-vaxx” slur enraged many who might otherwise have paid more attention to his articles on SARS-CoV-2 origins instead of using precious time and energy to craft responses to the trolling and trying to get Mr. Unz to grasp the very simple distinction between a corona-jab sceptic and an “anti-vaxxer.”

    So, in a sense he himself has co-created the phenomenon he now decries and bemoans.
    But he continues on the same trolling tack.

    Truly an own goal, for Mr. Unz.

    Sad state of affairs for alternative media and all those corona truth seekers who have been continually goaded and trolled by him.

    • Agree: meamjojo, sulu
    • Replies: @Mehen
  33. Skeptikal says:
    @Nancy

    “Besides, I found Jeffrey Sachs disgusting when he served the Russian oligarchs in the 90’s, and I have no reason to believe he’s changed masters …. anyone have a reason?) ”

    Yep.
    Unfortunately, for those with a functioning memory, this prior activity of Sachs casts a pall over anything that he says now.

    Many people, including me, sort of say, “Any port in a storm” when it comes to Sachs speaking out at least close to the side of truth and the angels. But like Colin Powell, his rep and credibility are tarnished.

    If he wants to be a strong advocate for a change in direction, he has to fess up regarding his disastrous role in the rape of Russia in the 1990s.

    Truth or consequences!

    • Replies: @Nancy
  34. Dumbo says:

    I, unvaxxed, had “Covid”. Most people in my family and among my acquaintances, vaxxed and unvaxxed, also had “Covid”. I know more vaxxed people who had it that unvaxxed. But in all cases it was more or less a mild flu that lasted about a week.

    Maybe the first wave was a bit harsher, but not by that much. The problem were the treatments (ventilation!) and the way the whole thing was handled, such as lockdowns and abandoning the old in care homes.

    Everyone at this point knows (or should know) that this Covid “pandemic” thing was mostly a scam to push for a new type of vaccines, which have proven useless, and probably also harmful.

    If I didn’t know that Ron Unz doesn’t have much of a sense of humour, I’d think he was just being facetious at this point, insisting with the “bioweapon” stuff.

    I mean, not to know that the mRNA “unversal coronavirus vaccines” were being discussed already in 2019 by Fauci, Bourla and others, just before the supposed “pandemic”? The vaccines were parr of the plan from the beginning, even before the beginning.

    • Agree: fish, meamjojo, sulu
    • Replies: @Wizard of Oz
  35. Skeptikal says:
    @Greta Handel

    “1) Which shot(s) have you had, and when?

    2) How many more do you intend? ”

    AFAIK Mr Unz has never answered those questions—often put to him— regarding his own jabbing history.

    • Replies: @Ron Unz
  36. H. L. M says:

    “These circumstances might seem to provide a perfect opening for the alternative media to play a crucial role, covering the important matters that a compromised mainstream media has so carefully avoided.”

    Quite a bit of the alternative media is now pointing out the obvious fact that

    1. there is no “pandemic”,
    2. the disease referred to as covid 19 caused by a deadly “virus” is a fiction,
    3. the “vaccines” are deadly.

  37. bobdslob says:

    An investigative journalist through FOIA requests has asked hundreds of health and laboratory institutions if they have isolated an alleged virus and if so could they provide a sample and it’s genetic sequence. To date 203 institutions, including the DHHS, NIH, and the CDC have said they have not isolated the Sars/Cov2 virus. As a former genetic lab technologist I will tell you that if you do not have the sequence then you cannot make a probe to detect it. The fraudulent test has driven this scam to get you to take a gene therapy shot, which has life altering horrors in it. Sars/Cov2 as Judge Judy would say, “is here say and not admissible in a court of law,”.

    • Troll: Wizard of Oz
  38. H. L. M says:
    @Darren Kelama

    Yes, of course.

    How can someone who writes articles on this subject not understand what’s going on?

    I say it’s impossible. Draw your own conclusions.

  39. Irwin says:

    There can be little doubt that the enemy is the international banking cartel headquartered in the City of London and on Wall Street, together with their agencies like the Bank of International Settlements, the IMF, World Bank, the global systemically important banks and institutions like the World Economic Forum, big pharma corporations, World Health Organization, Bill and Melinda Gates Foundation, GAVI and numerous others.

    Enjoy “poli-ticalfella-tio”

    • Agree: MarkU
  40. chris says:

    Almost to underscore Ron‘s point in this excellent article, I had gone to listen to Alex Jones after he was slapped with the ridiculous Sandy Hook lawsuit, and in his show, he referred directly to Jeffrey Sachs‘ shocking conclusion that Covid came out of a bio lab, WITHOUT telling his listeners that Sachs had said this was a “US“ bio lab!!

    Over the years, I had occasionally listened to Jones more for his entertainment value, but this type of gross manipulation is all the proof one really needs to understand the level of corruption we‘re dealing with at all levels of the entire media narrative spectrum.

    • Replies: @CBB
  41. Jim H says:

    ‘My own views on vaccines have always been quite mainstream.’ — Ron Unz

    And being ‘mainstream’ somehow validates them??

    One can’t be a red-piller on numerous other subjects, while appealing to ‘mainstream’ validation on ‘vaccines.’

    Current VAERS totals:

    Adverse reactions: 1,400,350
    Life-threatening events: 33,953
    Hospitalizations: 33,978
    Permanent disabilities: 57,598
    Birth defects: 1,159

    https://vaersanalysis.info/2022/09/09/vaers-summary-for-covid-19-vaccines-through-9-2-2022-new-chart-types-added/

    The ‘mainstream’ media won’t touch this subject. Alternative media are all over it. Why not Ron Unz?

    • Thanks: Abdul Alhazred, meamjojo
  42. Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly. As an extreme example of this regrettable tendency, a couple of months ago Dr. David Martin, a prominent and influential anti-vaxxer, warned that up to one-third of the American population would soon be dead from vaxxing, and demanded Nuremberg-style tribunals for those responsible for this looming disaster. Political activists or alternative websites can devote only a limited amount of time and space to a given topic, and the anti-vaxxing crusade has absorbed a huge fraction of all Covid-related interest.

    That is absolutely right.

  43. I 100% believe that most of the alternative media and pundits are the exact examples made by cass sunstein. Their existence is purely to buried websites like unz review or the moon. That is another version of muting your microphone, same as delisting you from search engines and jewish pundits stopped talking or even mentioning your name.

    The fact that the stupidest person on earth like alex jones got a few hundred thousand followers says it all. This also points to a sad fact, majority of alt media readers are stupid like him. I cannot be nice n call them excitable or naïve, they are just simply too stupid for any topic that requires brain activity.

  44. I could quote the readers of this comment section the official Irish ‘vital statistics’, as in births, marriages and deaths which, are released every 3 months, but suffice to say that deaths are up considerably on anything in the last decade,

    In my own small neighborhood of approximately 2500 households, neighbours are dropping at a rate never experienced before,

    Just this week I attended two funerals, both active healthy people, late fifties/early sixties, one just dropped and the second person was diagnosed only recently with an aggressive cancer that came out of nowhere and killed the unfortunate person within weeks,

    The parents of the person who died suddenly are still alive,

    Now this could be dismissed as anecdotal evidence, but not when the official figures show deaths increasing at alarming rates,

    Those that still cling to the idea that the jab isn’t causing real harm and death are going to be stuck, sooner rather than later, for an explanation into the rising death rates.

    • Agree: Mehen
  45. Tom Welsh says:

    “My own views on vaccines have always been quite mainstream, and I view the anti-vaxxing movement as a tremendously misguided distraction…”

    Unfortunate, in my opinion. Just because one enormous scandal has been hushed up, that doesn’t mean there can’t be another. Indeed, these two are intimately linked.

    Covid now seems to have been about as lethal as a bad flu season – no more, no less – although more dangerous for the old and sick than normal flu. Moreover, it seems to have killed more people in the USA and Europe than in Russia and China, so if it was meant to be a weapon it was either a very inefficient one or catastrophically mishandled.

    Therefore the “vaccines” were wholly unnecessary. That they seem to have killed and injured on the same order as many people as the virus itself makes matters that much worse. Perhaps the (vastly talked-up) virus was just a pretext for the “vaccines”, which carry the real biological payloads?

    The Russian evidence (and many other sources) prove conclusively that the US government has for years been energetically researching biological weapons. A few years ago, some people were thrown out of Russia after it was found that they had been paid by the Pentagon to collect DNA and tissue samples – but only from “ethnic Russians”. Why would the Pentagon pay for such work?

    It’s possible that Covid was a minor, relatively harmless intermediate product of Washington’s biological warfare program. It might have been released accidentally, or it might constitute one or more “sighting shots” to test how fast such a virus would spread and how much harm it would do.

    • Agree: allergic2katz
  46. BuelahMan says:

    Jeff Sachs Wiki:

    His family is Jewish.

    Its a non-starter from the get-go.

  47. JR Foley says:
    @Carlton Meyer

    Know any kids in the Big Apple? Tell them to forget getting a vaccine against polio. Tell them to eat their Count Chocolas and Froot Loops –if they fell ill —take them to church and get them exorcised.

  48. cohen says:

    I am 100% with bio weapon assertion. The gain of function business is going on in several countries and many cooperating with each others and providing financial help. Why all of a sudden this debate if Sar-2 is a bio weapon? who is behind it. Why this distraction.
    Where were all these guys when in 2019 when we were looking for Sar-2 causes and origin. Google search then showed US agencies holding most of the patent on Corona like viruses including UK, and Canada. That all magically disappeared in thin air

    My problem with this Bio Weapon are the “PUSHERS” of the theory. All this abstract work. We will blame several countries if there is a serious investigation conducted (I doubt it but you never know). Where is the debate on effectiveness of N-95 masks and 6 feet distancing or temperature monitoring by cheap Chinese manufactured thermometer without any calibration. what is the origin of this insane movement and to create panic among population.

    The argument to protect the other individuals does not meet the criteria of safety. Why dont we ban driving cara. Because any time a driver starts his car, he could be a risk to others.What about the untested drugs/vaccine and wrong prescriptions?

    Why Ron Unz has jumped into this debate, I dont know. But the old question still remails. Who are these people from Lancet to give a decree. Are they qualified? Most of them are economists
    . Here is my clumsy list from Lancet who is who.

    [MORE]

    1. Jeffrey D. Sachs is a world-renowned economics professor

    2 Salim S. Abdool Karim, FRS, is a South African clinical infectious diseases epidemiologist
    3 Dr. Lara Aknin is Associate Professor of Psychology at Simon Fraser University

    4. Dr. Joseph G. Allen is an assistant professor of exposure science at the Harvard

    5. Kirsten Brosbøl is the founder of Parliamentarians for the Global Goals

    6.Francesca Colombo, M.Sc., Health Division at the Organisation for Economic Co-operation and Development.

    7. Gabriela Cuevas Barron studied Political Science at the Autonomous Tech/ Institute

    8. María Fernanda Espinosa is an academic, diplomat and politician

    9.Vitor Gaspar, a Portuguese national, Dir. of the Fiscal Affairs Det. of the IMF since 2014.

    10. Alejandro Gaviria undergraduate degree in Civil Engineering

    11. Andy Haines is a “Professor of Environmental Change and Public Health”

    12.Peter Hotez MD Ph.D. is a professor of pediatrics and molecular virology

    13. Professor Dr. Phoebe Koundouri holds a PhD and MPhil in Economics and Econometrics
    14Felipe Larraín is Professor of Economics at Universidad Catolica de Chile

    15.Lee is research for Family Medicine/Primary Health

    16.Muhammad Ali Pate is the Global Director, Health, Nutrition at World Bank

    17. Gabriela Ramos Social and Human Sciences at UNESCO.

    18.Prof. K. Srinath Reddy has headed the Department of Cardiology

    19.Ismail Serageldin, new Library of Alexandria,

    20. Dr. Shah serves as President of the Rockefeller Foundation, for well-being of humanity.

    21. John Thwaites Chair of Sustainable Development Climate Works Australia,

    22.Dr. Vaira Vike-Freiberga was President of Latvia (1999-2007),

    23. Dr. Wang National Clinical Research Center for Respiratory Diseases in Beijing, China.

    24.Miriam Khamadi Were qualified as a Medical Doctor from Kenya’s University in 1973.

    25 Dr. Lan Xue is a Strategic Research Institute for Engineering, Science and Technology,

    • Thanks: Skeptikal
  49. Ronald Reagan accepted Lyndon LaRouche’s Strategic Defense Initiative through granting back channel talks with the Soviets. LaRouche was aware of scientific breakthroughs in the USSR concerning plasma physics, ands also aware, with economic collapse in both sides of the iron curtain that there were factions on both sides that thought tat a first strike was the means forward, against the Mutual Assured Destruction Doctrine
    .
    The LarRouche-Reagan SDI was a means of creating a science driver investment program in both spheres, of shared advancements, towards implementing technologies such that a First Strike could not be launched and would be thwarted, by both sides.
    It was the Bush/NWO faction that attacked the plan, attempting assassination of Reagan and railroading LaRouche to jail.

    LaRouche predicted the fall of the Soviet sphere 5 years before it happened, and fought against the Bush/British/NWO who sponsored Jeffrey Sachs in the conditionality’s plan to destroy the industrial capabilities of Russia. It was LaRouche to whom Russian economist Sergi Glazyev has influence Putin, where the BRICS and New Silk Road/Belt and Road initiatives come from Larouche .

    Thus there are still forces that seek World War III which means deindustrialization and the destruction of Nation States and hence the stunt that is playing out with this bioweapons blame game as another vector to have nation states fighting…

    Be wary of needles that are bullets injecting death for profit and slavery!

  50. MLK says:
    @jimbojones

    Thanks. Wittingly or not, Ron keeps serving up these straw man arguments. A bit less risible — though maybe we have to give Ron some time, routine that Jerry Springer perfected of putting on losers, freaks and fools to make the case for that which was to be knocked down.

    Perhaps Ron just wishes to feel better about himself for having been so wrong, intractably incurious, on the these experimental injections. After all, which is more obtuse, claiming SARs-CoV-2 “doesn’t exist” for a virus that mostly felled the elderly and otherwise immune compromised , or was said to be present in those who died by hospitals not performing autopsies but coding for billing purposes, and that somehow achieved what modern medicine never could — the near complete elimination of annual flu deaths; Or, studiously refusing to even mention, much less express any curiosity about the alarming increases in All Cause Excess Mortality and injuries in all population cohorts, correlated with mRNA injections?

    Let me belabor the obvious because it eludes some people. We long ago had sufficient information to conclude beyond question that both SARS-CoV-2 and the experimental mRNA vaccines are bioweapons.

    Whatever the origin of SARS-CoV-2, it immediately and then relentlessly was deployed as a Psychological Operation. Indeed, that should be plural given their political, ideological, and global scope.

    If Ron or anyone else wants to poke fun at fringe ideas, just read my comments on the starring role that the plandemic came to play in ‘Trump Must Go!’ after everything else, including the kitchen sink, had failed to derail him sailing toward reelection in a landslide on his evil Peace and Prosperity agenda.

    As 2019 was coming to a close, team ‘Trump Must Go!” was pretty much everyone who was anybody, foreign and domestic. Lots of promises were made, and they weren’t all state-to-state geopolitical and geoeconomic payoffs. It shouldn’t surprise that the Davos cult (WEF) put The Great Reset pedal to the metal once the illegitimate Biden regime was in place.

    That’s the tell that this Grand Conspiracy drew in the worst of the worst globally. Otherwise, the Biden Administration would have never rolled out the “vaccines,” at least not beyond the elderly and severely immune compromised that wanted it. They could have blamed the whole waste of money and time on terrible, awful Trump and regime media would have successfully sold that narrative to an American majority desperate to get back to the way things were.

  51. Ron Unz says:
    @Skeptikal

    AFAIK Mr Unz has never answered those questions—often put to him— regarding his own jabbing history.

    You’re just a delusional anti-vaxxer who probably hangs around this website because you’ve been banned everywhere else.

    I’ve said on several occasions that I had my two shots of the Pfizer Covid vaccine more than a year ago, and the only ill-effect was that my arm was sore for about a day. Last week I had my annual flu shot, and the consequences were exactly the same.

    I assume you were also a fanatic QAnon activist until you discovered you’d been taken in by a ridiculous hoax.

  52. @A123

    Even your imagination pulled up breathless. Look for the money. Another very small probability has to be the money motive which, say, led a speculator with mates in bioscience research or business to try and create market panics. March 2020 could have provided some very big pay days.

    • Replies: @A123
  53. Ron Unz says:
    @Weston Waroda

    But you appear to be overlooking the possibility that even alternative media outlets might become CIA assets…If the CIA can co-opt the mainstream media, it wouldn’t take much to entice alternative media.

    Whether it’s the CIA or other elements of the Establishment, I’m sure that what you’re saying is a significant factor.

    It’s probably a mix of such co-optation, fear, and various other factors, along with Cass Sunstein-type diversions into nonsensical blind alleys.

    And once the overwhelming majority of such alternative outlets can be warned away from a particular topic, the remainder follow along due to herd-mentality.

    • Agree: chris
    • Replies: @refl
  54. MEH 0910 says:


    [MORE]

    • Replies: @skrik
  55. @Dumbo

    You have drawn the wrong inferences from the early interest of Fauci and others in creating mRNA vaccines (or any other vaccines). It seems that Fauci’s arranging for gain of function research to be financed at Wuhan to avoid Obama’s restrictions created the need for cover up to avoid being held to blane in case that move was part of the causal chain leading to the pandemic.

  56. @Carlton Meyer

    I’ve had a good run, end it quick.

    Only the childless could say that, Carlton. By the way, GM2 is excellent. Better than ever. I wish your stuff was more mainstream. Be well, young man.

  57. geokat62 says:
    @Ron Unz

    I had my two shots of the Pfizer Covid vaccine… Last week I had my annual flu shot…

    I guess you’re onboard with the advice White House Covid adviser, Ashish Jha, recently gave to the American people:

    “I really believe this is why God gave us two arms, one for the flu shot and the other one for the Covid shot.”

    https://ca.news.yahoo.com/white-house-covid-adviser-causes-124704271.html

    • LOL: meamjojo
  58. A123 says: • Website
    @Wizard of Oz

    Another very small probability has to be the money motive which, say, led a speculator with mates in bioscience research or business to try and create market panics. March 2020 could have provided some very big pay days.

    The WUHAN-19 virus exit from WIV created opportunities for financial exploitation. Over hyping the fear was certainly lucrative. This would fit well in #5 Global Criminals. Instead of direct gains by BigPharma, it would be indirect gains by market manipulation.

    If it was intentionally caused by a corporate interest, the only plausible origin is WIV. It was obtained & released there knowing that it would go world wider.

    PEACE 😇

  59. @Commentator Mike

    Well what about them? How many and in what states of pre-existing morbidity or otherwise? What is the comparison you make that you think valid and informative?

    • Replies: @Commentator Mike
  60. @Ron Unz

    But no boosters.

    Pfizerite (Reformed)

    Thanks!

  61. @cohen

    Are they qualified?

    What do you mean by that ? Define qualified.

    • Replies: @cohen
  62. Jonny C says:

    The topics of the vaccines and the topic of the origins of Covid are not mutually exclusive, where one is worthy of discussion and the other is insignificant. There is ample evidence that both covid and the vaccines were in the works long before the outbreak, which certainly insinuates that there was a vast amount of insider knowledge ahead of time. Rewatch Event 201 for an easy example of this.

    The research that Ron Unz has done on the origins of Covid are extremely useful, and we should thank him for his work in that area.

    Unfortunately, on the vaccine side of things, he is very dismissive. He certainly uses “anti-vaxx” in a polemical way. But he may come around in the end, as he often does a year or two after the fact.

    I would strongly suggest that the origins of covid and the vaccines rather be looked at not as individual events, but as two parts of a preplanned operation. That is were the evidence points, and it would be extremely naive to think that the pharma companies didn’t have any idea this was going to happen. Now whether you think that the vaccines were prepared to mitigate the negative of effects of blowback, or to make sure to deliver harmful DNA changing spike proteins is a possible point of debate. But to dismiss the evidence of the latter is foolish and irresponsible.

    • Replies: @Stephane
    , @Wild Man
  63. No Putin cannot wipe out most of US population in an hour nor has he indicated he would like to try.
    There is no covid virus only seasonal flu that has been around as long as humans.
    Although the pyscho idiots in the US medicalbiowarfare industrial complex have built provocative biowarfare labs all around the edge of Russia, amongst othe places, they don’t know how to make anything that works killing people. This is about telling really scary stories to rob everyone with fake protection rackets against phantom threats. Unless you are stupid enough to get the injections which are poison. Too bad for you Ron.

  64. Wild Man says:
    @Ron Unz

    Why didn’t you take the mRNA booster as recommended?

    • Agree: Greta Handel
    • Replies: @Astuteobservor II
  65. sally says:
    @Weston Waroda

    Your observation that substantially all avenues in traditional and alternative digital media are policed, allowed or blocked by gangsters, corporate money power, political lies and steal power, digital thugs, and propaganda engineers suggest the time has come to consider developing a new form of media; one that cannot by the thugs who own the digital platform running on the Internet.

    A new means to inform the masses is needed. A means capable to circumvent digital surveillance and information prison is needed. Printed secretly circulated materials comes to mind but that is not enough I am afraid.

    Those with control over digital media have developed their control into a monopoly over all things digital and they use it to return the world to pre Martin Luther days.

  66. @Wizard of Oz

    I haven’t looked at the statistical data but going by anecdotal evidence and simple logic: with so many people vaccinated by now we are still having people getting Covid-19 and dying of it so I presume many of these must be fully vaccinated and boosted. Also, sure many of those so dying may not be in the best of health but some are.

    But I did check just now and data are available.

    https://ourworldindata.org/covid-deaths-by-vaccination

    Mostly it shows that vaccines and boosters lower the Covid-19 death rates but don’t eliminate them. Still if the vaccine worked then I wouldn’t expect anyone vaccinated to be catching Covid-19 let alone dying of it.

    • Replies: @ia
  67. Che Guava says:
    @Zachary Smith

    I don’t know, except that I’d never cite homeopaths. However, though extremely young at the time, I do recall both the cholera and smallpox vaccines having made me a little sick afterwards. Worth it for the protection.

    Have never had any type of ‘flu vaccine, including new corona, most people I know who received new corona vax said they had unpleasant symptoms after it, in some cases, quite bad.

    Also, nobody knows, will admit, or seriously analyse the apparent correlation between at least some types of corona vaccine and sudden death, often in very young and fit people.

    Since the vaccines aren’t even claimed to protect anyone now, the whole thing is very bizarre.

    • Replies: @Jeff Davis
  68. @Anonymous

    He’s a jew, so, no. Subversion and lies and denial and whining to the grave.

    • Replies: @lavoisier
  69. Stephane says:
    @Jonny C

    There is ample evidence that both covid and the vaccines were in the works long before the outbreak

    Actually it’s one of the selling point of the mRNA process : once the lipidic “packaging” part is mastered, it’s comparatively easy to tailor the mRNA strand for whichever viral bit you want and the actual production is more organic chemistry than biology.

    That’s how they were able to proceed so quickly as soon as the genetic sequence of the virus was published by the chinese.

    • Replies: @Jonny C
  70. anonymous[139] • Disclaimer says:

    This all may be just the tip of the iceberg that can be seen. What’s been done and what have they been working on that we don’t know about? What sort of contingency plans do they have? It’s seemingly illogical that the more devastating and catastrophic a nuclear exchange has likely become the more they toy with it in such a reckless manner and yet here we are with the unthinkable being floated in public discourse. Apparently the political leadership have become the owners of the American people as a farmer is the owner of his cows and chickens, deciding when they go to slaughter. Tens of millions are considered expendables by their owners. Nobody voted for that. The idea seems to be to hermetically seal off the public and have control of the information they are fed so as to have a completely compliant population willing to go along with anything. The 9/11 anniversary just passed to the sound of crickets. Thousands of Americans and millions living far away were expendables. Today things have been taken to new levels of risk, the stakes getting higher and higher and yet they just double down on it all.

  71. Covid-19 does not exist, it is a myth, an illusion concocted by the WEF, the Rockefeller and Gates Foundations, UN Agenda 2030, the WHO, the CDC aka the crime and death corp., etc., . Covid-19 is the flu and colds and pneumonia renamed to scare the people into taking the MRNA genocide shots and to make trillions off the injections at the same time they are killing the people with these shots.

    Now these same killers are pushing flu shots which they are lacing with MRNA, they are killers and they will not quit their genocide of the people of the world. Covid-19 and MRNA are the biggest depopulation and genocide operation in the history of the world.

    • Replies: @Anonymous
    , @H. L. M
  72. Decades ago and perhaps still today are the abundance of misdiagnosis regimes in the MS (Multiple Sclerosis) community where Lyme disease and other background events were the real culprit but never really examined and detailed out. 30 years ago in a MS swim/hydrotherapy group I asked 12 people within that group how many had mononucleosis in their youth. The response was 8. Way to high. It turns out the the Epstein-Barr virus which causes mono is now studied as a factor in MS development. The symptoms are remarkably the same in both mono and MS.

    A patient cured is a customer lost.

    • Replies: @anarchyst
  73. Seems most of the alternative sites I’ve read are on board with both covid being man made and the vaccines are bad. There has been debate over whether US or China made, but that also has been a bit of a shift to the Unz theory. What I don’t get is why Mr. Unz feels the vaccine comes from a pure intent. Quite frankly if I were a impowered psycho who invented and released a hybrid virus, I would make sure I controlled the treatment and vaccine as well. It would be the perfect plot of killing some people, scaring the surviving people, and then make a fortune off scared people. While making that fortune, I’d make sure they would be sicker for the next round of kill-scare-drugging until I have everything and they had nothing but their demise. Big Pharma scientists and officials would have to be complicit with my evil plans for it all to work.

  74. Wild Man says:
    @Jonny C

    “Unfortunately, on the vaccine side of things, he is very dismissive. He certainly uses “anti-vaxx” in a polemical way. But he may come around in the end, as he often does a year or two after the fact.”

    I haven’t experienced this ‘Unz coming around after, some years later, he finds himself alone on his side of his self-created cognitive-fence’ thing, yet. Is this really his modus operandi for theory-development (i.e. – throw some crap at the wall, and then use media & public response to that, to gauge which crap within said crap-storm is shite and which crap had some embedded golden nuggets)? And that it usually takes more than 2 years for Unz then to properly judge the outlines of such crap-tableau? Otherwise, before then, he is just seeing an abstract crapvention, and flogging that, to get the public & media rises, upon which he can make his judgments? Like some weird sort of performance art? If so, that would be a huge tell that, despite his intelligence, Unz’s common-sense-producing ‘intuition function’ sucks.

    If that is the case (that Unz’s common-sense-producing ‘intuition function’ sucks) what is his particular brand of very focused intellect, good for then, within the context of examinations of current events? Historical Revisionism? Doesn’t he get that his supposed pet approach (historical revisionism), is kinda a gutless approach, (i.e. – gutless by way of super-cynicism), whenever it is practiced whilst the events in question, are not really ‘historical’ yet, as these events continue to occur in the here and now? It’s surreal what Unz seemingly does here, that way. As such, all he has to do is talk without taking any real personal responsibility for the talking, and then see what happens, response-wise to the gaslit talk? And that, if what you say is true, then Unz’s methods are somewhat psychopathic (because his method, as such, would be a form of inverted gaslighting, … performed in order, not so much to fool others, but to inform himself, by way of public & media responses to the gaslighting, without helping inform those gas-lit , …. oh I guess on that part, he does then inform those he prior gas-lit, but way after the fact, if they are even bothering to follow him after all that abuse, after the full scope of his historical revisionism methods have ripened). But there will be no thank-you for those he prior abused to perform his theory-making operation by way of judging responses to the gaslighting method, only continued derision – right? A mocking that ‘these parties were too stupid to see through my methods, they get what they deserve’? Is that Unz’s take on the great western invention, the dialectical method? As such, is Unz truly even a westerner?

    But at least he is championing Sachs, and at least Sachs is trying to reveal to the world what was already known among readers of alternative media sites.

    • Replies: @Jonny C
  75. @MLK

    And thus arises the consideration that Trump and his crew (Bannon?) were in the low level bioweapons game against China and Iran. Was Trump ‘removed’ because of unauthorized use where others (Senate/House) had no knowledge of these attacks? It explains a coup d’etat in the dead of night against a clear victory for Trump.

    Bannon was declaring the fall of the government in China in June 2020 while hanging around a Chinese virologist. You can’t make this stuff up. Okay well… maybe you can.

  76. @Franz

    Hard to believe with the data out on various medical sub-stacks now not to mention a hell of a lot of anecdotal evidence not yet collated because of criminal government/media obstinance, that anyone would consider the jab. Interesting you mentioned shingles, my 30 plus year old step-son recently came up with shingles totally out of the blue. Yes, he’s been jabbed and boosted but shrugs off the notion those inoculations may have been the cause of the condition. It’s pretty frustrating trying to get through to the indoctrinated.

    • Agree: Franz
  77. cohen says:
    @Charles Martel France

    Just glancing through the educational and professional background of the Commissioners of Lancet Covid commission anyone can say these experts have no business in getting involved in Covid business specially Mr. Jeffery Sachs an economist. Why dont we get Alan Greenspan, Paul Krugman, and trhow a few lawyers in the commission just for diversity.

    My personal experience with UN and the World bank……. these are charity organizations or free loading. Once you get in you made it. Go to the world bank and have lunch in the World bank Cafeteria, you just pay a few bucks for a heavy lunch (all kind of international foods).

    I had once asked a question to a World Bank presenter who kept bragging about how world bank is spending billion, gazzilions here and there…… I asked him if he could name one successfully completed program in environmental field. No answer.

    If you look at their environmental guidelines and rules manual they are all copied from USEPA ruling and procedures with World Bank Logo.

  78. Bert says:

    Two Japanese computational biologists demonstrated (link below) that the Omicron variant was almost certainly created in a laboratory. This confirms my evolutionist’s initial reaction to seeing a phylogeny that placed Omicron not as a descendant of previous strains, but rather derived from the base of the SARS-2 tree, yet with many mutations. Omicron was therefore presumably created and released to tamp down the pandemic, which had done its work in cowing much of the West’s population.

    https://zenodo.org/record/6904363#.Yx3Nx6TMKUk

    The circulating Monkey Pox strain will likely be shown to have a similar low probability of being natural.

    The Great Reset will be facilitated by new pathogens which will be deployed and paused at will. Perhaps Monkey Pox is intended to make the handling of cash a health risk, so that digital currency can be more easily imposed. You know, if ivermectin can be sidelined, then so can vinyl gloves and hand sanitizer.

    When the fog of speculation is thick, facts or at least overwhelming probabilities matter. The high probability of Omicron being an intentional creation which was release for a purpose should require reconsideration of all hypotheses regarding SARS-2.

    • Agree: hardlooker
    • Replies: @Levtraro
  79. anarchyst says:
    @RoboMoralFascist 1st

    The same situation existed with a bacterial cause of stomach ulcers. An Australian doctor came up with a method for treating them with anti-bacterials. At the start, he was criticized by the medical establishment as it was thought that excess stomach acid was the problem, but after extensive research, it was recognized that he was right, all along.

    • Replies: @RoboMoralFascist 1st
  80. MLK says:
    @Ron Unz

    What’s a “fanatic QAnon activist?” You’re just upset about the subject matter. Otherwise, you’d wrote one of your interminably long pieces about your journey to vaccine nirvana despite all of those terrible, awful “anti-vaxxers” trying to convince you to go without.

    Your touchiness is a glaring tell. I can’t be the only one to observe that those who willingly accepted the experimental injection, let alone forced them upon their minor children, would now rather see themselves and their loved ones die or suffer debilitation from the medication than admit that, informed big brains and all, that they had been played.

    • Agree: chris, Emslander
    • Replies: @Jeff Davis
  81. Anon[330] • Disclaimer says:

    The issue of vaccination and its dangers is a much debated one. However, the history of vaccines and their dangers, real or apparent, do not really apply in the case of the Covid “vaccines”. They are vaccines in name only as they use a very different technology from previous vaccines.

    For the present these “vaccines” are unique so the dangers, if any, must also be viewed as unique. It is unfortunate that they bear the name of vaccine for they deserve a new name and a new category which will make clear that the history of vaccines does not really apply to them. Rather the history of the mRNA technologies, predecessors, and derivatives does and will apply.

    There is no reason not to consider the idea that both the original virus and the “vaccines” are bioweapons. The artificial virus is then the justification for the fake vaccine. If the damage of the fake vaccine can be attributed to the virus then the fake vaccines can increase fear of the virus and justify taking more of the fake vaccine. The two do not stand in isolation, but are complementary.

    That the claim the virus is a bioweapon created in US’ labs should certainly scare the authorities more in the short run for widespread belief in its truth would be a major blow to the credibility of the media and the legitimacy of the US government. The “vaccines” will be such a threat only after the death rates rise high enough to breach the media silence and the government’s “safe and effective” claims.

    One must expect that if the “vaccines” are kill shots the government is prepared for the arrival of that day. The government need not be prepared for the revelation of its part in the original virus creation which could come at any time.

    It is evident that the media and the government are owned by the same people. Therefore the censorship and calumny heaped upon opposition is very high if not airtight. It probably does not need to be airtight and might raise questions if it were. As it is such opposition can be dismissed as simply a fringe of kooks. It will take direct experience of the truth by a large part of the population to overcome the media generated reality imposed on those lacking such experience.

    The true curse of information transmission is that relatively few situations allow for mass direct experience to contradict media generated realities. Humanity really needs more effective means to transmit the truth about any proposition. Do not expect such a boon to come from lying media and governments.

    • Replies: @Commentator Mike
    , @Nancy
  82. Treg says:

    Or Ron, the banning of your articles and videos has been more thorough than you thought. I was banned just several weeks ago, “violated community standards” yet again, but of course you’re never told what it was exactly. It could have been a few links to your essays and videos. Who knows.

    (Sometimes I wonder if SOMEWHERE inside these 50 States there is a Small Claims Court Judge that would agree with me that stifling my free speech is a \$5,000 offense – Google/Youtube/Twitter/Paypal PAY UP! I will leave that question all to the lawyers in the room)

  83. @tanabear

    I had 24 people working for me at my last job last year (last job because I was let go for jab refusal) and only one was good with getting the jab. Every other person there went along with it because they had a family to feed and most put it off as long as they could as adverse data started trickling out. I was able to move on because I was a year or two from retirement anyway but frankly, if I was younger and still jammed up to pay the family bills, I would have likely succumbed to the pressure. Somebody needs to pay.

    • Thanks: Nancy
  84. @tanabear

    The Kirsch article is another excellent piece.

    Mr. Unz writes:

    Apparently, our response to extremely disturbing information is to censor it, under the Ostrich-like principle that “what we don’t know can’t hurt us.”

    This is NOT the process.

    It’s obedience to and compliance with authority. The truth is the enemy of the state. The only way this changes is show trials and severe punishment of authorities and their agents. Like a hundred of them. I doubt that it will be happening any time soon.

  85. Like 9/11, this crime is perpetrated by the same mafia goons that control finance, Western governments, media/entertainment, academia, and the medical establishment. Only Russia and China have the power to ostracize them internally and eventually to overthrow them externally, but I wonder whether their leaders fully recognize the enemy within.

  86. whataliar says:

    origins….smorigins….

    i listened to robert boyle discuss the gain of function research at chapel hill and wuhan in april of 2020 on tthe alex jones show. i don’t think you can get a more distinguished guest to go over the facts even at that early juncture. for all of those naysayers that attack jones, they don’t realize that he actually has the best guests that are
    not allowed on mainstream media.

    we are anti vaxxers and were watching with dread how the mainstream media was stepping up it’s attacks on anti vaxxers leading up to covid. also the actions of new york state in taking away all vaccine exemptions in the same time period. we could see the writing on the wall. you can’t tell me that this was not in the works ahead of time.

    while predictions of millions dead from the vaccine are irresponsible, one doesn’t need to even look at these dire warnings to see that the vaccine is dangerous. unless you believe that the main cause of unexplained death is…..

    unexplained death.

  87. I’m prepared to accept Mr. Unz’s virus origins hypothesis. However, if it’s true, then essentially the same people who designed the virus designed the vaccine, yet he appears to have few misgivings about the vaccines. I think much more skepticism on his part about the vaccines would be warranted.

    • Agree: allergic2katz
    • Replies: @Jim H
  88. @anarchyst

    Remember a guy named Dr. Stanislaw Burzynski in Texas that started have great results in treating cancers? Or how Stromectol/Ivermectin has shown excellent results outside the U.S. and is OTC in Mexico, Japan, India etc.

    This is a controlled market environment game. A patient cured is a customer lost. Putting one crowd out of business requires another development to stay in business… and in control.

  89. Peterike says:

    Our elites regard Russia as our bitter international adversary

    No. Our JEWISH elites feel this way. Media was totally pro Soviet because of Jewish media control. The media is now totally anti-Russia because of Jewish media control, mostly because Putin put a stop to the Jewish looting of Russia. Jews want the Russian piggy-bank back, even though they still control a great deal of it. It’s not enough. They want it all.

    The Ukraine war is the same thing: Jews all the way down.

  90. @kit walker

    The anti-vax movement needs to wake up and recognize that both COVID and the MRNA vaccines were probably developed simultaneously by essentially the same people/forces. The military origin of the vaccines explains three things about them that anti-vaxxers don’t like:

    (1) They aren’t very safe, because the military is not that concerned about safety, as exemplified by the over-vaxxing of Gulf War I troops leading to hundreds of thousands being disabled with Gulf War Syndrome.

    (2) They are only temporarily effective, because the military is perfectly happy to order troops (or civilians in a biowar environment) to keep getting boosted.

    (3) They are semi-mandatory (most people found it hard to work, travel, attend public gatherings, send their kids to school, etc. without submitting to a vax they didn’t want) because again, the military doesn’t mind ordering people to do things, and knows that as we enter biowar-saturated World War III they are going to have to start routinely ordering people to get vaccinated against the bioweapons they use against their adversaries.

    Conclusion: The anti-vax movement needs to morph into an anti-bioweapons peace movement.

  91. MarkU says:

    Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly.

    I think a lot of people (myself included) are convinced that proving that Covid-19 was created in a lab is going to be a tall order in itself and that proving that it was used deliberately as a bioweapon is going to be even harder. This is an argument that could go on for years with no guarantee of success. Meanwhile, the assault on civil liberties and freedom of speech continues unabated as does the assault on basic standards of vaccine safety.

    Why is it normal for vaccines to be tested for about a decade before they are certified for widespread use? Is it because…

    A) The regulatory bodies are sadistic entities that hate people and want them to die of preventable diseases.
    B) They want to prevent pharmaceutical companies from making profits.
    C) Both of the above.
    D) There is a significant risk of long-term side-effects that might take years to show up.

    Remember that we have had decades of experience with dead/attenuated virus vaccines and yet we still have enough issues with them that we subject them to proper long-term tests. Yet when dealing with completely new, experimental gene-therapy style vaccines, we can dispense with all normal safety protocols and set out to ‘vaccinate’ the entire human race without any long-term testing at all. I mean what could go wrong?

    Why is Ron Unz apparently blind to the enormity of this development? It is not sufficient to simply argue ‘Some or even most ‘anti-vaxxers’ are loonies or saboteurs, therefore the issue can be dismissed out of hand’ (you could say the same about 9/11 truthers) I also note that Ron Unz is using the blanket term ‘anti-vaxxer’ in exactly the same way as the establishment uses the term ‘conspiracy theorist’ (ie as a dismissive pejorative)

    To be clear, I had no particular issue with the initial use of the mRNA ‘vaccines’ on the elderly or vulnerable (as an emergency measure) I did have issues with the suppression of other treatments, the extension of the program to the young and healthy and the demonization of those of us that decided to decline (this is not an exhaustive list by any means)

    • Agree: allergic2katz
    • Thanks: Mehen, Jim H
    • Replies: @A123
  92. Did Covid originate from eating bat soup or was it man made? If man made, was it accidentally released or an intentional bio weapon? WE WILL NEVER KNOW.

    What is obvious is that the MSM and the permanent bureaucracy who hated Trump used the pandemic to steal the election with mail in ballots.

    The virus has mutated to a much less harmful strain (like most viruses do). The vaccines are no longer effective (if they ever were).

    Let’s move on. I’m tired of hearing about Covid.

  93. Agent76 says:

    Nov 23, 2020 Gates to a Global Empire over Seed, Food, Health, Knowledge and the Earth

    The report gathers evidence and throws light on the dangers of philanthrocapitalism, which is boosting the corporate takeover of our seed, agriculture, food, knowledge and global health systems, manipulating information and eroding our democracies. Over the last 30 years it has emerged as a major force, able to derail the international agenda and push our future and the future of our planet towards extinction and ecological collapse.

    https://www.transcend.org/tms/2020/11/gates-to-a-global-empire/

  94. @MLK

    “Whatever the origin of SARS-CoV-2, it immediately and then relentlessly was deployed as a Psychological Operation.”

    Bingo. And the fact that Ron Unz can’t (or won’t) grasp this suggests something nefarious about his motives in continually pushing this particular angle.

  95. BioPharma called and said…

    We do not now have and have never had any kind of forward looking view as to viruses and their effect upon population groups. We never study that and have no working knowledge of such a thing. Ignore all the labs and lab work splicing and patenting and the motives of money and profits connected to contracts and mysterious releases of bioengineered (non zoonotic) economic weapons against the pork and poultry industries. We are different… we are above greed and mass murder. Turn your head and cough.

    For those who are breaking ranks and revealing insider stunts… well you’re a nobody conspiracy theorist kook now instead of being head of our department.

    FIBWA in the U.S. Army once stood for Field Identification BioWarfare Agents. You can ignore that history now.

    Just stop thinking and do what you are told. Who did you say was your health insurance bookie?

    And stop ordering those prescription low cost generics from online overseas providers. Just because Trump made it legal to do so… doesn’t make it right. Besides all those counterfeit drugs will get you killed. Pay the U.S. dollar cost for your meds at Walgreens and you can live without fear.

  96. geokat62 says:
    @Kevin Barrett

    Conclusion: The anti-vax movement needs to morph into an anti-bioweapons peace movement.

    Conclusion: It’s the military, goy!

  97. @Ron Unz

    “I’ve said on several occasions that I had my two shots of the Pfizer Covid vaccine more than a year ago, and the only ill-effect was that my arm was sore for about a day.”

    Why haven’t you gotten the booster(s) and the new “updated” shot like the CDC recommends?

    What are you…an anti-vaxxer?

    • Agree: Greta Handel
  98. A123 says: • Website
    @MarkU

    I think a lot of people (myself included) are convinced that proving that Covid-19 was created in a lab is going to be a tall order in itself and that proving that it was used deliberately as a bioweapon is going to be even harder. This is an argument that could go on for years with no guarantee of success.

    Proving that the Wuhan Institute of Virology was capable of making the WUHAN-19 virus should be straightforward. Coming up with a way to shift the source to another location (e.g. Fort Detrick) seems virtually impossible.

    Mr. Unz would be better off if he repackaged his conspiracy as an anti-American attack. Smart honest people grasp that there is no reason to surreptitiously transport WUHAN-19 thousand of miles when WIV modified coranaviruses were easily available locally. Especially since WUHAN-19 was guaranteed to “go global” regardless of where it was released.

    I also note that Ron Unz is using the blanket term ‘anti-vaxxer’ in exactly the same way as the establishment uses the term ‘conspiracy theorist’ (ie as a dismissive pejorative)

    To be clear, I had no particular issue with the initial use of the mRNA ‘vaccines’ on the elderly or vulnerable (as an emergency measure)

    I have offered better terminology several times:

        ♦ Vaxx-Realists
        ♦ Manda-vaxxers

    This would stop focusing on the fringe few who think Bill gates is micro chipping people. Instead it would push the attention onto authoritarian government overreach. Where does the Constitution state that individuals can be coerced into an experimental mRNA program?

    Vaxx-Realists accept that for those who are over 65 with pre-existing conditions, the experimental jab may be worth the risk. However, they also understand that giving the jab to healthy children and young adults makes no sense absent very unusual circumstances.

    PEACE 😇

    • Agree: MarkU
    • Replies: @cohen
  99. Nancy says:
    @Skeptikal

    And, if this “Wait !!, NOW we see it is a nefarious lab source!!” pivot is a calculated effort to muddy the rising vax death numbers and evidence, so as to protect the ‘vax villains’, then Jeffrey is still serving his Khazarian Mafia masters (who are masters of 3D chess).

  100. SafeNow says:

    Ron focuses on the coverage failures of alternative media; and mainstream media (which means, overwhelmingly, left wing.). Good as far as it goes. But what about media outlets that are both large, and, conservative? Of course that leaves us with a field of – – small-field alert – – two. The WS Journal is a lost cause. The NY Post’s coverage failures are anomalous to me, because I agree with their editorial board and columnists on every single issue except the proxy war in Ukraine, and the biolab aspects of Covid’s origins. If The Post would properly cover these, the impact would be enormous. Especially now, because the NYT recently conceded that The Post was correct about the laptop.

    Of course the proxy war and the biolab issues are intertwined. Why the coverage failure? Sad to say, but my thoughts turn to Biden’s flanking himself with Marines. And my thoughts turn to the crew of The Liberty being told to remain silent, or face pension loss…”or worse.”

    • Replies: @RoboMoralFascist 1st
  101. Karl1906 says:

    Many people still remember (fondly) when Scott Adams turned from “smart sceptic” to “insulting zealot” in regards to the vaccines. But he most likely hypnotised himself. It happens with self-deluded “successful” people when they smell their own farts too often.

    Besides, Unz.com is also “counted” (mostly by leftists) as “alternative media” and thus the problem of bankruptcy – moral AND political – is also the problem of this site.

    No, I’m not interesting in reading or debating on Mr. Unz’s position while steadily more and more proof is being released and confirmed. And the complicit criminals beginning to formulate their excuses and exit strategies. You never needed alternative media to come to this point, just listening to the people who were never interested in politics was enough to know what’s been going on since 2019.

    9/11 had its 21th “anniversary” yesterday and we all know WHICH version ended in the history books. Remember the painting of George W. Bush Epstein had in his mansion? Yeah, exactly. The complicit US-establishment is still having a laugh – at our expense – over this.

  102. geokat62 says:

    Must watch video!

    Excerpt from “The Many Lies We Were Told…” My Explosive Interview with Dr Jessica Rose
    Dr Jessica Rose’s Expert Analysis of the Damning VAERS Data and More!
    :

    My highly revealing interview with Dr Jessica Rose exposes ‘the off-the-charts’ safety signals seen in VAERS (Vaccine Adverse Event Reporting System)- the rise of unusual cancers; myocarditis particularly in young males; fertility and menstrual challenges faced by thousands of women.

    Dr Rose lists the shocking number of serious adverse event cases:

    Thrombosis 81,000
    Myocarditis 38,000
    Hospitalizations 300,000
    Liver problems 66,000
    Life altering injuries 31,000
    Disabilities 53,000

    https://soniaelijah.substack.com/p/the-many-lies-we-were-told-my-explosive

    • Replies: @cohen
  103. Good to know that Ron Unz and many others here came to the same conclusion as I did. That many of the theories endorsed by the alternative media complex simply do not make sense and apparently only serve to obfuscate things.

    I would go a step further and claim that the alternative media complex is actually in bed with the mass media. Its role is to inform us about (some) reasonable and justified theories and concerns while also simultaneously broadcasting batshit crazy conspiracy theories, that are easy to debunk or just logically incoherent. That arrangement makes it easy for others to dismiss the reasonable concerns because the same person, channel etc. that informed us about them also informed us about space lizard people in the government.

    It’s easy to see how that scenario plays out. People who did not want to take the Covid jab because of safety issues, after all it is a rushed product, or because they were simply hostile to how the government dealt with it, are represented or just usurped by interest groups that claim that the shot contains mind-altering nano particles, makes your baby’s eyes turn black or takes away your soul.

  104. Nancy says:
    @allergic2katz

    I continue to hope that Ron is being ‘blackmailed’…. maybe being allowed to keep his glorious website in exchange for beating the ‘CIA source’ drum (and ‘antivax attacks’ :).

    After all, if we overlook the ‘source’ stuff, we have a unique, nay, irreplaceable place for truth. How many want to lose the UR if they can assuage their ego with ‘defeating’ his vax stance? How often does the ‘perfect is the enemy of the good’ strategy drive a possible good out of the picture?

    My real education started (I’m 76) when I began his Pravda series…what a gold mine ..in one place! And his large viewership gives hope that truth will get beyond the choir. I do not question his motives….. yet. Thanks, Ron.

  105. Since getting the vax, my mother has had a heart attack, my aunt has had constant new multiple health problems, my good friend has had a heart attack, my neighbour had major blood clots a day after the jab and it was admitted by her doctor it was due to the vaccine, another neighbour had a heart attack within an hour of the vaccine, my cousin has had a return of cancer.
    These are just a small number of people I know directly within my circle who have had health problems from the jab. I was never an anti-vax person, but I am now and I will never trust the government again.

  106. @jimbojones

    You took your medicine like a good boy and were lucky enough to suffer no consequences.

    Not yet anyway.

    The mRNA vaccines cause the inoculated cells to produce the spike protein. The spike proteins thus produced — in addition to stimulating the immune system to produce protective anti-bodies — cause cellular damage, which manifests in a broad spectrum of vaccine-induced injuries, myocarditis/pericarditis being the most widely publicized of these injuries.

    Rarely mentioned is the almost certain infliction of widespread — I would argue likely universal –damage that remains subclinical, and thus “under the radar”. Subclinical means the damage is there, but does not — yet — cause symptoms severe enough to be identified by either the victim or their doctor as vaccine injury.

    Only the passage of time will reveal the human health consequences of this wide-spread, low-level vaccine-induced injury. The “vaccinated” will provide the long-term safety data for these vaccines, the world’s human population being the guinea pigs for that vaccine-safety research.

    Good luck.

    A personal note: My wife and I, retired, in our early seventies, living in a remote, semi-isolated Mexican backwater, minimized social contact for the first year, bulked-up with readily available HCQ + zinc, Vitamin D, and then ivermectin, and avoided the vaccines. When the dangerous Delta was replaced by the nearly trivial Omicron, we breathed a sigh of relief, shed any lingering fear, and with no small amount of self-satisfaction celebrated our having dodged the vaccine “bullet”.

    Now we wait to see if (1) the thesis of a monstrous bioweapon crime is investigated and then possibly proven, and (2) what the ***long-term consequences*** will be for the first-world populations that so-enthusiastically submitted to multiple vaxxing and boosting.

    One detail: Russia and China developed and employed more conventional non-mRNA vaccines !!!

    Good luck to you all.

    • Replies: @hardlooker
  107. skrik says:
    @MEH 0910

    9) The FCS of SARS-CoV-2 has codon usage unusual for bat SARS-related coronaviruses and has an 8-of-8 amino-acid-sequence identity to the FCS of human ENaCa

    Sorry; wrong.

    [ENaCa is more correctly written ENaC-α]

    The “codon usage” bit is correct but the “sequence identity” is not correct.

    Here is a mini-proof:

    1: ENaC-α snip:
    ________R__R__A__R__S
    ______CCCGTCGAGCCCGTA

    2. The 12-nucleotide spike insertion snip:
    _____p__r__r_
    _CTCCTCGGCGGG

    3. SARS-CoV-2 spike snip:
    __S__P__R__R__A__R__S
    TCTCCTCGGCGGGCACGTAGT

    One can clearly see that the codons of the ENaC-α snip do *not* match those of the SARS-CoV-2 spike snip.

    Q: What else does your Richard H. Ebright get wrong? rgds

  108. Nancy says:
    @Andy Kauffman

    So, if you’re right, what is causing the ‘epidemics’ of livestock disease? Especially in China? (BTW, I want to believe you, but)

    • Replies: @Fatmanscoop
  109. @Anon

    The Chinese ones are vaccines, at least in the way they’re prepared.

  110. Jimmy1969 says:

    A brilliant analysis and one of many long overdue criticisms of our media….who 95% consist of cheerleaders for vested interests. But it is more than just the media…it is Universities, Political candidates at all levels, School Boards, Corporate Boards, and Pro Sports owners, and Madison Ave and 99.9% of Government workers, both City and State and Federal and a thousand regulatory boards and commissions and the Judiciary too. They all stink of fear to say one single word wrong. The question is who is making out from creating this fear? Who is manufacturing this consent, this mobilization of bias? Cui bono? Regarding the Media, at least the US has some alternative outlets…Britain and down under and up there in Canada they have none.left …and Canada as I have said dozens of times is an intellectual Gulag. They do not have a single right wing Politician in the Country nor a single right wing media outlet. Every right wing outlet has been shut down and even moderate right politicians like Maxime Bernier have been falsely branded as Hitlers and ruined. Take a look at their actual speech laws and in addition compare their laws regarding guns and other protective measures that we have, and you will see that despite Trudeau and his Liberal woke affirmative action inexperienced jokes being branded as far left clowns…the Country is actually a Fascist State. One single word wrong up there and you are fired. Look into what they did to the old Sports Dog Don Cherry…a 50 year icon ruined over one line. And Canada and Britain and down under are all part of the Mafia that Mr. Unz is talking about.

    • Thanks: CelestiaQuesta
  111. @allergic2katz

    “Whatever the origin of SARS-CoV-2, it immediately and then relentlessly was deployed as a Psychological Operation.”

    Bingo. And the fact that Ron Unz can’t (or won’t) grasp this suggests something nefarious about his motives in continually pushing this particular angle.

    Let me state it this way : if someone puts surreptitiously a deadly venomous snake in your bedroom would you say that the snake was deployed as a Psychological Operation with no intention to cause you any physical harm ?

    • Replies: @allergic2katz
  112. I’m beginning to connect the dots on why our dark overlords hate us so much. Why they’re salivating and warmongering over the vast rich natural resource lands of Russia and must end any and all claims of sovereignty and religious protection from globalist predators removing legal barriers for sexual degeneracy.
    We either defeat this despicable enemy of humanity or become Atlantis 2.0, another vast erased wasteland buried in the ash heaps of history.

    • Agree: Emslander
    • Thanks: Weave
  113. Magchiel says:

    Ron seems to forget that also shortly a Chinese Government official for the first time told the Chinese people that the 9/11 attaques were home made. This information also didn’t make it to the Western press. One of the two chinese Americans who assisted Prof. Hulsey with his decisive Building 7 investigation emigrated to China after the completion of their four year study.
    Magchiel

  114. Isn’t it ironic that the common cold/flu has been eradicated and now anyone with sniffles, cough, or sneeze is demonize as having any number of new bio weapons unleashed on humanity.
    The shame that many are experiencing by being shunned and victimized is despicable, when it was they who have caused this attack on humanity.

  115. Yes, in the current climate alternative media isn’t going to rock the boat, especially when there is no “I did it” documentation out there. It is also tribal and nationalistic. You can figure out who is a MAGA Republican based on their beliefs on the origins of the virus and the safety of the vaccines. To admit that the US did a large biological attack on humanity, you’d have to admit that the US is one of the most evil countries in history. The establishment is siccing Newsguard on alternative media too along with the de-platforming. There is only suspicion that the US did Covid. We know the DIA knew about Covid before China at least publicly acknowledged it. We know that Fauci and EcoHealth was in bed with the Covid researchers in Wuhan. Jimmy Dore (Moderna’s vaccine injured him) and Sam Husseini have done great work on discussing Covid: https://husseini.substack.com/p/how-fauci-channeled-cheney

    Wuhan is also where they researched the monkeypox virus. They built part of the virus themselves instead of importing it from Africa. There was a simulation last year, the premise of it was that a biological attack using the monkeypox in the West would occur in May 2022. Guess, what happened? Monkeypox appeared in May 2022 in the West. Why isn’t Ron Unz all over this? Is it because the monkeypox hasn’t hit it big yet?

    I learned about the Wuhan research into monkeypox by watching Jimmy Dore. He was showing clips from Dr. John Campbell: https://www.youtube.com/watch?v=4E6cD-VWhQY

    If you say vaccines are safe then get only Moderna’s boosters. People I know who took any of the other vaccines didn’t have problems. The ones that did take Moderna’s vaccine felt bad, or are now under the care of a cardiologist for myocarditis. No one talks about the 800 pound elephant in the room, which is, did big pharma have to use the pointy spike protein for the vaccines? I remember reading some researcher quoted in an article claiming that using the spike protein was a mistake, hinting that they could have created a safer vaccine. The answer to that will decide how crazy the anti-vaxxers are. If they could have developed the vaccines so it didn’t tear up people’s cardiovascular systems, why didn’t they? Either they couldn’t, didn’t care, or it is part of the “Great Culling” conspiracy.

  116. The hypersonic missile is just an air launched ballistic missile. Every ballistic missile is hypersonic and the Russians do not have anything we don’t have.

  117. ‘…Yet oddly enough, while most of our mainstream media routinely castigated and condemned Reagan for his occasionally harsh rhetoric against our Communist Russian adversary, today virtually all of our major media regularly spews forth vastly harsher condemnations of Christian Russia and its leadership….’

    This bit in particular is indisputable: Reagan — and earlier! I’ve always been struck by how exactly the same segment of the American political spectrum that used to advocate detente and coexistence is now all for vitriol and confrontation. I remember what was fashionable in 1970. I can see what’s fashionable now.

  118. Anonymous[408] • Disclaimer says:
    @Desert Fox

    U have been reading my mind. Enjoy!

    • LOL: EdwardM
  119. SafeNow says:

    My Kindle library recently disappeared, and I can now better understand Ron’s belief that one is best served by printing downloads or buying hardcopy books.

    Of course my library contained many books by conservative authors. At the risk of sounding like a conspiracy theorist, I will speculate that perhaps an alphabet agency’s algorithm decided it was time to whack my library. I had referred to it frequently. Sometimes I recalled that a particular book contained a particular quotation or argument. Using a word search, I quickly found it. I was then able to use this quotation in a letter to a newspaper or a posting on Unz. Or simply reread the passage in question for my own understanding.

  120. @Weston Waroda

    “ The CIA is flush. And the CIA would be highly incentivized to swiftly kill a story of the US government engineering a deadly virus and deliberately unleashing it on the world.”

    From my perspective, that’s what they’ve been doing since day one. Threaten Big tech with removing their protection clause, declare them publishers or else censor, ban, and cancel as we demand. Notice how they all did it in unison and within minutes of each other. The same threats went to payment portals, big box, and all the usual cast and crew, do as you are told or face the wrath of a tyrannical government, BLM/Antifa and endless burn loot murders and rape of your stores and management staff.

    Anyone not seeing these blatant attacks on the First, Second and the free flow of commerce, hasn’t been paying attention.

    And the scary part is that it’s all directed by the scum in DC and their money handlers, and we all know who they are.

  121. @Wild Man

    New mutated variants are not as deadly. Take omicron, spreads at 4-5x the rate but with very very mild symptoms.

    Mutations anon, do you know it?

  122. DrMike666 says:

    No doubt there is an official cover-up and Sachs should be getting more attention.
    However, accepting that the virus is engineered we are left with 4 (realistic) possible scenarios : 1 & 2 accidental release by China or US; 3 & 4 intentional release by China or US.

    #1 – has a huge amount of evidence. See my link. Subsequent china and US actions match the model
    #2 – no evidence, CV19 would have first appeared elsewhere (i.e. US or Ukraine)
    #3 – 3D chess level game theory conspiracy shit – damage oneself economically and political stability wise to harm opponent. Not believable. China’s panicked initial response belies this
    #4 – Ron presents nice pieces of thread in Pravda series but can’t make a rope. All the coverup evidence makes more sense with #1. Why would the US be making the bioweapon at WIV with Shi Zheng-li? tons of proof her lab was doing the g-o-f work but no evidence of US asset in the lab. Why would US IC let Daszak talk in online interview about the US funded g-o-f work right as we attack china?

    https://purescience.substack.com/p/covid-19-origins-cover-up

    • Replies: @Ron Unz
  123. Anonymous[379] • Disclaimer says:

    Americans are ‘provincial’ and care more about the jab because it affects them more directly than the issue of who made and spread covid 19.

    The jab is not a vaccine and is only so by redefining what a vaccine is.

    Also, while some of the more extreme skeptics have come up with ridiculous claims — jabs will kill billions! — , even the most aggressive pushers of the jab are now backtracking because the evidence is now so overwhelming. There’s now even an attempt to pin all the blame on Trump for hurrying it along.
    The jab has killed more and caused more harm than the real vaccines in the past combined. While it may have had some use in alleviating covid symptoms among the very old, there’s no reason for young people, especially children, to take it. But it’s been pushed on everyone. All the jab mandates were power-grabs. When even people who developed natural immunity to covid are urged to take the jab, it’s about control than medicine. Consider the famous tennis player who had covid and developed natural immunity but is still denied participation in US Open.

    It may be true that the powers-that-be would prefer that the people obsess about the ‘vaccines’ rather than pry into how the whole thing really began, but the lies surrounding one are interrelated with lies around the other. So, instead of either/or, our approach should be more comprehensive in exposing the web of lies that extend from the deep state to big pharma to pentagon. As Putin said, US now heads an Empire of Lies, and no big lie exists in isolation but in tandem with other big lies.

    As for alternative media, while there are some with sympathy for Russians, there’s hardly any with any sympathy for the Chinese(and Iranians). So, even if they suspect the US may have used it as bio-weapon against China, they don’t want to go there because it morally favors China, vilified by everyone from Alex Jones to Tucker Carlson.
    If the globalists tend to hate Russia most, nationalists have been led to hate China most. Trump ran on peace-with-Russia and hostility-toward-China. So, all those in the Trumpian orbit will not want to pry into whether Trump administration had anything to do with pulling a dirty trick on China, especially as Trump himself not only blamed China but demanded China pay reparations in the trillions to the whole world.

    And if the US really did it, there are neocon fingerprints all over, and that means Jewish involvement. No one wants to step on that third rail as the biggest taboo in the West is antisemitism. Even the sacrosanct blacks have been destroyed or blacklisted for going there.

  124. Dystopian says:
    @MLK

    When I read the line about 18 million dying from Covid I had to stop reading. If a person gets into a car wreck and bleeds out later in the hospital what did they die from? Obliviously if they hadn’t been injured in the accident they would not have been bleeding. To take that analogy on step further imagine upon arrival in the hospital doctors gave anticoagulants and refused to use any of the typical treatments used to stop bleeding. I seriously doubt that 18 thousand people actually died from Covid alone. With an average of 4 comorbidities these folks were already in god’s waiting room and were sent to the other side by not using drugs that work, Redesivier, Opiates, and vents.

    • Replies: @Marcion
  125. @SafeNow

    Sad to say, but my thoughts turn to Biden’s flanking himself with Marines.

    There is nothing like falsely claiming to be the POTUS while surrounding yourself with 25,000 – 30,000 troops to prevent the American people from killing you.

    • Replies: @fish
  126. Marcion says:
    @SafeNow

    Did you complain and get the books replaced by Amazon?

  127. Anon[378] • Disclaimer says:

    Mr Unz., you’ve made some very good arguments in this article as it pertains to the failure of alt media to cover the seemingly explosive allegations made by Russia and Mr. Sachs.
    I would like to offer an alternative explanation I’ve not noticed here as well as a criticism. Unlike many here, I am not so filled with hubris that I would resort to questioning anyone’s intelligence or integrity for not seeing things exactly as I do. I try to consider all possibilities until one is proven beyond reasonable doubt. With the amount of propaganda, misdirection and lack of verifiable data and competing agendas of everyone, its pretty easy to become misled. This applies to all of us. So those of us who consider ourselves to be dissidents should try to approach these arguments and theories with an open mind, free of emotion and judgment. with that said.,
    I think a possible explanation for the lack of coverage is that most of have become jaded and suspected instinctively that the u.s govt was involved in some way with developing c19 as either a world killer or a test run. So it surprises almost none of us to see these allegations. This assumes that c19 isnt simply a bad flu, which I also see as a possibility. What IS surprising and more unexpected and obviously true is the mandates of these “vaccines” when by definition don’t meet the criteria for being called such., which compelled the cdc to literally redefine the term. These are facts and not debatable. Allegations are not facts even if we might think them likely., and as jaded as we’ve become, they aren’t going to draw the same attention.
    For my criticism, Whatever you think of these “vaccines”, whether you trust that they’re viable or a biological Trojan horse., You must see theirs a big difference between these and the conventional vaccines we’ve been accustomed to and have no objection to.,for example mmr shots. I may be in the camp of those who see these covid shots as dangerous but that doesn’t make me or those like me an “anti vaxxer” That is a divisive and insulting comment I would expect from the msm., not from you. An “anti vaxxer” is necessarily against any and all vaccines. People like me on the other hand are just against these ones in particular. That’s a big difference which you seemingly fail to realize. My hope is that it was unintentional and you simply used the term as shorthand but if this is the case, a disclaimer would’ve been helpful in avoiding some of the negative commentary. Otherwise good article.

  128. Ron Unz says:
    @DrMike666

    #4 – Ron presents nice pieces of thread in Pravda series but can’t make a rope. All the coverup evidence makes more sense with #1. Why would the US be making the bioweapon at WIV with Shi Zheng-li? tons of proof her lab was doing the g-o-f work but no evidence of US asset in the lab. Why would US IC let Daszak talk in online interview about the US funded g-o-f work right as we attack china?

    You really should read my Covid articles. The Wuhan lab probably had nothing to do with Covid, and there’s ZERO evidence of any lab-leak. Meanwhile, I might as well include a few of the key paragraphs supporting my own analysis, though you should read the entire text or watch my video interviews:

    For example, in 2017 Trump brought in Robert Kadlec, who since the 1990s had been one of America’s leading biowarfare advocates. The following year in 2018 a mysterious viral epidemic hit China’s poultry industry and in 2019, another mysterious viral epidemic devastated China’s pork industry…

    From the earliest days of the administration, leading Trump officials had regarded China as America’s most formidable geopolitical adversary, and orchestrated a policy of confrontation. Then from January to August 2019, Kadlec’s department ran the “Crimson Contagion” simulation exercise, involving the hypothetical outbreak of a dangerous respiratory viral disease in China, which eventually spreads into the United States, with the participants focusing on the necessary measures to control it in this country. As one of America’s foremost biowarfare experts, Kadlec had emphasized the unique effectiveness of bioweapons as far back as the late 1990s and we must commend him for his considerable prescience in having organized a major viral epidemic exercise in 2019 that was so remarkably similar to what actually began in the real world just a few months later.

    With leading Trump officials greatly enamored of biowarfare, fiercely hostile to China, and running large-scale 2019 simulations on the consequences of a mysterious viral outbreak in that country, it seems entirely unreasonable to completely disregard the possibility that such extremely reckless plans may have been privately discussed and eventually implemented, though probably without presidential authorization.

    But with the horrific consequences of our own later governmental inaction being obvious, elements within our intelligence agencies have sought to demonstrate that they were not the ones asleep at the switch. Earlier this month, an ABC News story cited four separate government sources to reveal that as far back as late November, a special medical intelligence unit within our Defense Intelligence Agency had produced a report warning that an out-of-control disease epidemic was occurring in the Wuhan area of China, and widely distributed that document throughout the top ranks of our government, warning that steps should be taken to protect US forces based in Asia. After the story aired, a Pentagon spokesman officially denied the existence of that November report, while various other top level government and intelligence officials refused to comment. But a few days later, Israeli television mentioned that in November American intelligence had indeed shared such a report on the Wuhan disease outbreak with its NATO and Israeli allies, thus seeming to independently confirm the complete accuracy of the original ABC News story and its several government sources.

    It therefore appears that elements of the Defense Intelligence Agency were aware of the deadly viral outbreak in Wuhan more than a month before any officials in the Chinese government itself. Unless our intelligence agencies have pioneered the technology of precognition, I think this may have happened for the same reason that arsonists have the earliest knowledge of future fires.

    According to these multiply-sourced mainstream media accounts, by “the second week of November” our Defense Intelligence Agency was already preparing a secret report warning of a “cataclysmic” disease outbreak taking place in Wuhan.  Yet at that point, probably no more than a couple of dozen individuals had been infected in that city of 11 million, with few of those yet having any serious symptoms.  The implications are rather obvious.  Furthermore:

    As the coronavirus gradually began to spread beyond China’s own borders, another development occurred that greatly multiplied my suspicions. Most of these early cases had occurred exactly where one might expect, among the East Asian countries bordering China. But by late February Iran had become the second epicenter of the global outbreak. Even more surprisingly, its political elites had been especially hard-hit, with a full 10% of the entire Iranian parliament soon infected and at least a dozen of its officials and politicians dying of the disease, including some who were quite senior. Indeed, Neocon activists on Twitter began gleefully noting that their hated Iranian enemies were now dropping like flies.

    Let us consider the implications of these facts. Across the entire world the only political elites that have yet suffered any significant human losses have been those of Iran, and they died at a very early stage, before significant outbreaks had even occurred almost anywhere else in the world outside China. Thus, we have America assassinating Iran’s top military commander on Jan. 2nd and then just a few weeks later large portions of the Iranian ruling elites became infected by a mysterious and deadly new virus, with many of them soon dying as a consequence. Could any rational individual possibly regard this as a mere coincidence?

    The Iranians themselves were well aware of these facts, and their top political and military leaders publicly accused America of an illegal biowarfare attack against their own country and China, with their former president even filing an official protest with the United Nations. But although these explosive charges were widely reported in the Iranian press, they were completely ignored by the American media so that almost no Americans ever became aware of them.

    https://www.unz.com/page/covid-biowarfare-articles/

    Perhaps you can explain how this crucial but almost never reported evidence fits within the framework of a Wuhan lab-leak.

    • Thanks: TKK
    • Replies: @A123
    , @James N. Kennett
  129. A123 says: • Website
    @Ron Unz

    Of course, this is readily explained without a complex conspiracy to move the WUHAN-19 virus around the globe. The Israeli government is 100%, totally, completely uninvolved.

    Let me summarize. Individuals claiming to have a document mysteriously appeared in Apr 2020 (~6 months after the purported release). They could have:
    ♦ Deployed 6 or more “intentional leakers”
    ♦ 4 of the “intentional leakers” targeted ABC in coordination
    ♦ 2 additional “intentional leakers” targeted Channel 12 in coordination.

    The coordinated, 2-prong effort successfully targeted one reporter at one Israeli TV station, Channel 12. Finding motivation or leverage to roll a single individual at one outlet is not that difficult envision.

    — Can you prove that the 4 way coordinated leak targeting ABC was from the U.S. government? What are the names of the officials?

    — Can you prove that the 2 way coordinated leak targeting Channel 12 was from the Israeli government? What are the names of the officials?

    — Can you prove that these are separate sources, not 1 well organized plot with 6 (or more) coordinated operators?

    — Can you prove that a DIA/NCMI document exists? If it does, can you provide a copy? Or, even a single page?

    PEACE 😇

  130. Rurik says:

    Great and provocative article as usual.

    I consider it a certainty that the bio-labs in Ukraine were for the purpose of bio-weapons to be deployed against the enemies of ZOG. But in strategic ways, of course. And the dearth of reporting on all of that is exactly what I (and I’d think you) would expect.

    That said, this tweaked me a bit

    As the serving chairman of our Covid Commission,

    “our” Covid Commission?

    Curious, I checked,

    https://covid19commission.org/

    it appears to be funded by the Rockefeller foundation, and some other Islamic oriented foundation. Both committed to the same work towards ‘global tolerance, inclusion and fairness’ that has come to define our times.

    So yes, I suppose it’s fair to say ‘our’ commission, but that certainly doesn’t represent anyone like myself, for instance. Or any of the people I generally know as peers.

    Not that that means they have no credibility, just that from my perspective, from their credentials, I’d consider them as much as ‘our’ organization or experts, as I would the CDC or Dr. Fouci.

    IOW, the closer you get to government or Rockefeller, Ford Foundation type of credibility, the less you have, IMHO.

    I offer that simply for what it’s worth.

    I’m no expert on these matters, and suspect that you’re right about Covid being facilitated by the very people who were all supposed to trust to protect us from it.

    • Thanks: Nancy
  131. Marcion says:
    @Dystopian

    6 Million times 3.

    18 million, triple holocaust means
    Pharma-Gov rules. The sex-needle thrusts are your initiation into worldwide Jewry.

  132. gay troll says:

    Say Ron, there’s an emergency outbreak of polio in New York State, and so the Governor is encouraging everyone to get vaccinated against polio.

    It turns out that this strain of polio is literally derived from a vaccine. A polio vaccine that was banned in the U.S. more than twenty years ago but was still considered good enough for the third world. Your BFF RFK Jr. claimed it killed almost 500,000 children in India alone.

    So, to recap, polio was once eradicated in the U.S., but thanks to polio vaccines, there is a new strain of polio breaking out in New York. And the solution to this is more polio vaccines.

    WTF is this, planned obsolescence? The WHO and CDC would make GE blush. Talk about creating a demand for your own products.

  133. @Che Guava

    Since the vaccines aren’t even claimed to protect anyone now, the whole thing is very bizarre.

    Not at all bizarre. It’s all about \$\$\$\$\$.

    Big Pharma owns the FDA. And at this point they have a nation filled with terrified, broken-brain, do-as-they-are-told Fauci worshipping Dem-bots, who will enthusiastically vax and boost till the end of time … or the end of their lives, whichever comes first.

    So who can be surprised when Big Pharma continues their irresistibly profitable grift: The govt has already ordered 170 million doses of the new Omicron-variant “vaccine”. So Pfizer/Moderna have already locked in more billions for their execs and stockholders: \$3.2 billion for the first 105 million doses, with an option to buy 195 million more.

    Witness the looting of a dying empire.

    • Thanks: Che Guava
  134. ia says:
    @Commentator Mike

    Thanks for the link.

    Chile seems to show almost no difference between vaccinated and unvaccinated.

    The US graph only involves people older than 50 and it’s just for a few months this year.

    Then there’s the problem of categorizing deaths as Covid or another comorbidity. From what I’ve been reading hospitals and doctors are encouraged to classify as Covid even though they might have merely tested positive. And the PCR tests can be rigged to positive based on the number of cycles. More cycles means you can find anything.

    • Agree: Nancy
  135. Jim H says:
    @Robert Gore

    ‘essentially the same people who designed the virus designed the vaccine, yet he appears to have few misgivings about the vaccines.’ — Robert Gore

    Precisely. Papers published by EcoHealth Alliance authors and their collaborators at Wuhan Institute of Virology going back to 2015-2016 state clearly that research into novel spike proteins and potential vaccines proceeded in parallel.

    One can’t indict bad people who developed Sars-CoV-2 in a lab without conceding that the same bad people developed the spike protein containing mRNA vaccines. These have proved to be the most disastrous public health intervention in human history, as databases from multiple countries (not just VAERS) establish irrefutably.

  136. A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere, probably now encompassing some 15-30% of the American population and almost monopolizing online Covid discourse.

    Is it entirely fair to describe the anti-vax mob as “militant” without also acknowledging that the pro-vaccine mob did not suffer from a shortage of militancy when it came to attempting to force the vaccine on people whether they wanted it or not?

    Even after it became widely known that taking the vaccine would not prevent the spread of Covid, the pro-vaccine faction never relented. They still insisted on vaccination being treated as a public health matter long after it was not. Equally dubious was the suppression of legitimate reports of adverse side-effects from the vaccine as “misinformation” on the Internet.

    Had the pro-vaccine lot not made it plain that they were okay with forcing people to take the vaccine at a form of de jure gunpoint, perhaps the need (real or imagined) for “militancy” on the part of the people who opposed them would never have developed? As it happened, the pro-vaccine folks made it plain from the beginning through both their actions and their strident rhetoric that anyone who did not wholly share their views was a non-person who did not deserve to associate with so-called decent folk (i.e. them).

    If you are frustrated that the Covid dialogue now consists largely of two groups talking past each other, please take a step back and look at how this came to pass. The old saw about like deserving like applies here as it does with all human affairs.

    In short, one group of people, however large and/or well-intentioned, cannot treat those outside it badly without repercussions. Perhaps the pro-vaccine people will re-think their “my way or the highway” approach the next time they want something from fellow members of their society?

    • Agree: MarkU
  137. Weave says:
    @Carlton Meyer

    That was the most hopeful line of the article! This bs of men being women and gays force feeding our children their wonderful lifestyles and people only being guilty or innocent based purely on their skin color is unsustainable and unfixable.

    My advice is to get right with God.

    • LOL: TKK
  138. @meamjojo

    You do realize that despicable Hag Victoria Nuland responsible for Ukraine’s 2014 coup to install a US patsy head of state admitted under oath to congressional committee that there were many US funded bio labs in Ukraine.

    Have WokeHysteria?

    • Agree: MarkU
    • Troll: Wizard of Oz
    • Replies: @meamjojo
  139. TheMoon says:
    @Carlton Meyer

    Fuck you. I have a new family. Off yourself if you’re so comfy with death.

  140. fish says:
    @RoboMoralFascist 1st

    Hiding behind men with guns while pretending to be a tough guy has been Biden’s MO for 50 years.

  141. TheMoon says:

    The bioweapon so powerful, most people didn’t know they even had it, and they had to come up with a crap test with lots of false positives to inflate the numbers.

  142. TKK says:
    @Franz

    My elderly mother had a total of 3 or 4 (bullheaded) and she has had irregular heartbeat, panic attacks and a feeling of heat and pressure on her head where she breaks out in a sweat yet she is freezing, increased dementia.

    Her elderly sister had a rapid loss of hearing and smell, and had to get hearing aids.

    Her church friend also developed atrial fibrillation, malaise and loss of smell.

    I don’t think it is normal aging as these ladies were highly active, and big time vax advocates. They don’t want to believe they were duped. They are heart sick that these vax could be so destructive to the last years of their lives.

    It is sad- my mother used to be sharp as a tack and she is slipping everyday. It increased exponentially after the vax.

    • Replies: @Franz
    , @The Real World
  143. Mark Hunter says: • Website

    A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere …

    What an infuriatingly blinkered view of actual events. The movement against the so-called Covid vaccines sprang from massive evidence that those drugs are ineffective and dangerous.

    Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly.

    That “fervent” gets RU off the hook, I guess, but he presents a package deal. The better “anti-vaxxers” – to use his term – are in fact interested in Covid’s origin. (For example, Dr. Meryl Nass has posted a lot about that subject on her blog. RU himself mentions RFK. Jr.) However I think they are right at this time to give priority to stopping the clot shot, it being the immediate threat whereas Covid is out of the bag.

    … a couple of months ago Dr. David Martin …

    No reason to drag in that blowhard. He is not nearly as influential as RU claims, especially not in comparison with Drs. Peter McCullough and Robert Malone.

    RU says that Covid has killed over a million Americans. The statement is a half truth. The whole truth is that Covid along with the suppression of safe, effective, and inexpensive treatment killed over a million Americans. 80% – who can know for sure? – were killed because such treatment was willfully withheld.

    Sure, the origin of Covid is important. Does RU think the suppression of treatment was unimportant? Does he think Fauci and friends are honest men?

    Getting back to the Unz Hypothesis, to my mind the most telling argument in its favor is the Covid outbreak in Iran immediately after the outbreak in China. It is otherwise difficult to explain. RU might refer to a biowarfare attack against “Iran (and China)” rather than against “China (and (Iran).”

    As for RU’s precognition argument, it depends on the date of the outbreak, which is hazy. And that American lab assistant who praised the leakproofness of the Wuhan lab is not reliable. (Didn’t she help the CCP’s PLA acquire military technology via China’s civilian-military fusion policy? If so she is a traitor.)

  144. Like many, my wife and I were very wary of taking either the Pfizer or Moderna vaccines.

    However, since Johnson & Johnson created a standard vaccine for COVID (not MRNA) we opted for that one without any side effects or long terms consequences.

    As everyone is probably aware, the J&J vaccine was never really promoted and was allowed to slide into obscurity to the point that it is no longer producing it.

    I suggest that this was done on purpose as J&J did not follow the party-line, which was mostly driven by money and instead attempted to produce a formula that would actually solve the issue.

    In any event, neither my wife, nor I, intend to take any so-called boosters from Pfizer or Moderna. And we are not allowed on a plane so what. Who wants to fly in increasingly uncomfortable conditions so that the airlines can continue to make money?

    As to the vaccine being an actual bio-weapon released on purpose from the Wuhan labs, that seems to be a little far-fetched considering that Phil Garadi stated a while back that such weapons are designed to target a specific population, not spread across the globe infecting everything in site.

    And the lethality of the COVID virus is actually not much larger than a very bad flu. A majority of the deaths from COVID (around 78%) were with people who had at least 4 co-morbidities and\or were obese. In other word, a lot of these people were already on their way out. Even the CDC has stated that the mortality rates being reported are highly exaggerated.

    I do believe that something more than an accident was involved at these labs but I believe the jury is still out on these issues.

    However, Jeffrey Sachs, an economist by training was the only person to request investment assistance to the former Soviet Union after its collapse and was completely ignored by the US neoconservatives who were given license to plunder the dying Russian state.

    As Naomi Klein reported in her excellent book, “The Shock Doctrine”, Sachs was not a part of the neo- conservative rape of Russia but has been blamed for such.

    I believe he is on to something as the Russian researchers are but we will find out more when the Russians make their case in Geneva.

    I would think that many in Washington should be quite worried because there is probably a Russian hyper-sonic missile somewhere already carrying its destination label on its side… Washington, DC…

    • Replies: @Johan
    , @niceland
  145. It seems Unz has made a case for the opposite of his conclusions. The US/Isreal/Hollywood is an Illusionist State but Russia is not? Maybe that is why the US is unafraid of Russia’s super-duper missiles?

    Jeffrey Sachs? My gosh, he is the one who, along with many fellow tribalists, looted the USSR during its dissolution. Lancet is a journal almost entirely controlled by Big Pharma and the Chicoms. What qualifications does Sachs have to be associated with that medical journal?

    Sorry, turtles all the way down on everyone.

  146. Johan says:

    Jeffrey Sachs is also a climate change alarmist, thus a ‘Lord of Illusion’. There is no bargaining here in the sense that most people are victim of some type of scheme of lies. Alleged human caused climate change is the major fraud of frauds, with the biggest potential of all frauds, it is about the master fraud scheme of all schemes currently running. Besides, since virology in itself is a criminal fraud, a pseudo science, the fact that the man holds an inconvenient narrative, doesn’t make it any better.
    It doesn’t help much to exchange one fraud for the other.
    If you ask me, at best the title Special Lord of Illusion is applicable.

  147. Weave says:
    @jimbojones

    Your post mirrors my family’s experience exactly. My mother-in-law did not speak to me or my kids for over three months last year because I would not get them vaxxed “for her.” She is in her 80’s and cared more about her own gnarly old hide than the possible and unknown side effects to my 14 and 17 year olds. Even after she finally allowed us back into her home she treated us like we were diseased.

    Those who so readily did as they were told are culpable. What comes to them is their own fault.

  148. @MLK

    I can’t be the only one to observe that those who willingly accepted the experimental injection, let alone forced them upon their minor children, would now rather see themselves and their loved ones die or suffer debilitation from the medication than admit that, informed big brains and all, that they had been played.

    My sister has a doctorate in chemistry and is exactly one of those big-brained liberals. She lives in a upscale suburb on the outskirts of Philadelphia with her equally accomplished doctorate-in-chemistry husband. While I have a great deal of affection for her, always have and always will, her liberal brain is broken, and our politics are on opposite poles of the political spectrum.

    When I spoke with her on the phone and asked about her vax status, hoping to persuade her to skip the “vaccines” for her young-enough-to-be-virtually-immune grandchildren, she very proudly and enthusiastically indicated that she and her two sons and their children were all double vaxxed and boosted. From early in the pandemic I had seen reports of the severe adverse events, and was concerned for my sister’s welfare and the welfare of her children and grandchildren.

    Too late.

    I would agree with your comment, but I would soften it a bit. I would suggest that they don’t so much resist accepting the truth because they don’t want to admit having been played. I suspect that they do not want to accept the truth because it is too painful for them to accept that their children and grandchildren may have been gravely injured.

  149. Nancy says:
    @Anon

    “It is evident that the media and the government are owned by the same people.” Too true… just look at their names! all Irish!!! …. er…. well, just look at their names!

  150. Johan says:

    Regarding vaccinations, the renowned philosopher Herbert Spencer, an acknowledged and widely appreciated authority in his times, the father of sociology, the first one to embark on a theory of evolution (before Darwin), and the first to formulate a theory of relativity (before Einstein), in one of his books, where he describes the inherent incompetence of governments, already gives an account of small pox becoming epidemic after the government had enforced a large scale vaccination program, and most of the people had been vaccinated. Numerous books meanwhile have been published regarding the falsified data and arguments which pro-vaccination authorities use.

    It is thus unfortunate that the contemporary people who are not members of the vaccination church engage in far fetched speculations about the number of deaths Covid vaccinations might produce, and that they engage in other fantastic stories, in some of which there might be truth, but for which there is often too little evidence. But this is the unfortunate side effect of the democratic internet, and democracy in itself, that fools and intelligent man both have alike access to the publishing system and media.

    At large there are two kind of people, the sheep who obey authorities, and fools which produce far fetched and bizar theories, the latter tend to grow overnight like mushrooms, and they tend of have a contagious effect. There is no need for any scheme to push bizar and idiotic theories, folklore is full of them, and history is full of them, they grow spontaneously like weeds. The two, the authorities of the sheep and the authorities of fools easily over-shout the minority of thoughtful rational people.

  151. Thomm says:
    @jimbojones

    Go do a public debate with Steve Kirsch or McCullough or Del Bigtree or Mercola and let’s see what you and the public think after that.

    I don’t think you have figured out the true purpose of this website.

    Furthermore, look at this recent video with Ron Unz about his Covid Conspiracy. Not for the content though.



    Video Link

    What stands out is that Ron Unz looks terrible for a man of just 60 who has as much discretionary time and money as he has. We don’t have to compare him to Tom Cruise who is almost exactly the same age, but in general, a lot of people in their 70s appear to be in better condition than Ron Unz at 60.

    His hairline alone is a disaster. Simple Zinc supplementation could have greatly delayed this. In fact, ‘disaster’ is not a strong enough word, since his ‘Jewfro’ hair texture precludes the combover that he wishes he could implement. He may need hair-straightening techniques from black women as a prerequisite for the eventual combover.

    Ron Unz has the look of a man who has realized that he lives in the exact epicenter of the tech industry, yet missed the greatest tech boom ever even as it happened all around him. Steve Kirsch added \$500M to his net worth in this tech boom alone (2010-present). Meanwhile, Ron Unz spent the same period pushing narratives he knows to be untrue, such as ‘Hispanics have converged up to whites in crime rates, IQ, and more’, and ‘Covid was a biowarfare attack by the US against China’.

    To add insult to injury, Steve Kirsch nonetheless excelled in Covid thought leadership to a greater extent than Ron Unz, even as Steve Kirsch was out partaking in and harvesting wealth from the tech boom while Ron Unz was on the Internet pushing narratives even he knows to be untrue.

    The regret of it all is evident in the massive acceleration of Ron Unz’s aging.

    As Chazz Palminteri’s father told him, there is nothing sadder than wasted talent.

  152. @SafeNow

    “Break Your Cloud Drive Addiction with a Home Cloud”

  153. Many of us have long ago concluded that the US media is defunct. The alternative media is virtually extinct from an economic point of view. They are being destroyed by economic warfare. Demonetized, banned, etc.

    There was also the Syrian chemical weapon hoax in which the OPCW, the international body tasked with investigating chemical weapon use, has been corrupted. There was virtually no coverage.

    https://thegrayzone.com/2021/04/18/at-un-aaron-mate-debunks-opcws-syria-lies-and-confronts-us-uk-on-cover-up/

    About the Vaccines:

    The vaccines endanger us at a personal level.

    The mandates attack our autonomy.

    The passports / credit score / monitoring attack our personal liberties.

    Also, they are not done. Their model for the vaccines seems to be the same as for computer software i.e. constant updates. They just released an update for people 12 and over.

    This bio weapon is deniable by design. It requires a higher level of authority to resolve it, if that ever does happen. It needs a super-national or trans-national approach.

    Not much we can do except adopt a defensive posture and hope for the best.

    • Replies: @Abdul Alhazred
  154. cohen says:
    @A123

    The despicable and shameless Israeli agent reemerges.

    Despite the gact several of the commentators despised his stupid 123 Peace Emoji while spewing hatred against Palestinians.

    I wonder how Germany is going to pay the recreations to current free loaders and future holocaust survivors who are in preschool ages.

  155. @Charles Martel France

    That’s a loaded analogy, because you can’t compare Sars-Cov-2 (fatality rate of around 0.1%) to a deadly venomous snake in the bedroom. At least, not in good faith.

  156. The author is incorrect to assert that Sachs finds the virus was engineered. Sachs states in his PNAS article of the possibility of it being such given the FCS mimicry.

  157. @Franz

    “Ron, I’d seriously reconsider the vaccines.”

    He won’t. Like Steve Sailer, he’s got the Boomer belief in the sanctity of Science. Unz has done tremendous work on COVID 19, but he’s silent on the role mRNA plays in the intentions of those who deliberately released the weaponized virus. He sticks to the “anti-vaxx” pejorative like an idiot savant.

    • Replies: @Mis(ter)Anthrope
  158. harfang67 says:

    I think people are affraid. They know something very big is going to happend to America and they just don’t know what to do. They are also aware of all the destruction their leadership has caused ariund the world and are also aware of how powerful “the real power” that controls their country is, e.g. was able to carry out (cover-up included) the “9/11” operation right here in America (killing somewhat 3000 people) to justify the invasions of Afghanistan, Iraq, Syria, etc, the JFK assassination , the US Liberty 67 ship, etc. They have to be very powerful people and organisations to conduct such operations and “clear” any obstacle.

    I just Read “Globalization and the Crucible of Global Banking” by Patrick M. Wood and my “hunch” is that the people “behind” the BIS are very dangerous. We can probably go as far as to even consider them as “non-humans”( biological humans with no soul, no conscience). Anyway….

    Your contributions are of fondamental importance for us to discover “who our real ennemy” is (from a famous war strategist).

  159. meamjojo says:
    @CelestiaQuesta

    You d realize that your brain circuits are burned out and that you suffer from delusions of competency?

    • Replies: @MarkU
  160. cohen says:
    @geokat62

    More shoes to drop.

    Where the 1 million death in US is coming from. Any backup data. People dying in Covid years vs dying because of Covid. Throw the death certificates entries.

    Remember 6 million or 6 billion magic number?

  161. nsa says:

    “Russia’s arsenal of 6000 warheads…….”
    The Rooskies have a well deserved reputation for doing everything the hard way. They should have listened to commandante nsa after a couple of high octane 24 ouncers:
    Shockski and Aweski were required on the first day of hosilities to avoid a proxy war with the USSA and its 29 nato butt bitches i.e. take out the entire west ukie power grid and let the globohomoschlomo simps live in the dark, starve, and eventually eat each other. Maybe self-preservation would kick in and 10 million ukies would exodus overruning several of the eastern euroweanie satraps. They could all hover around the fireplace burning crap ikea furniture to stay warm this winter. After 6 months of pointless carnage and destruction, the blundering Rooskies are finally turning the lights off in parts of ukiestan by taking out the power grid piecemeal. Too late…..it’s already a globohomoschlomo proxy war directed by the yids running the USSA. The survival of the Russian Federation is at stake.
    But all is not lost. Give the ukie nazis a whiff of the grape…..er radiation. Time to try out a few of those 50 year old enhanced radiation devices…better known as neutron bombs? They contain only 2 to 3 pounds of fissionable material, produce very little infrastructure damage, but kill everything in a contained 2 mile radius including morons inside tanks and shallow bunkers. Discretely used, they could take out complete armies while harming very few civilians and leaving all infrastructure intact. The alternative for the blundering Rooskies is a nato nazi globohomoschlomo proxy forever war on their border draining manpower and resources for many decades to come…….

    • Replies: @Stonehands
    , @Rurik
  162. Johan says:

    Here is Jeffrey Sach’s climate change alarmism, all of what he mentions is tendentious nonsense, propagated by hysterical scaremongers, all of it debunked, and nothing has become reality. If you write about what you know nothing about in this way, how does that reflect on other areas? even if for one time he doesn’t blindly follow the main stream narrative. Halleluja, someone among the institutional elites mobs for once suggests the plausibility of an alternative narrative.

    https://www.project-syndicate.org/commentary/changing-climate-change

    • Troll: MarkU
  163. meamjojo says:
    @InnerCynic

    NYT? Such a fount of objective truth.

    /s

    I don’t think you wanted to use the /s tag, since in this context it means that you actually do believe what the NYT wrote. [lol]

  164. H. L. M says:
    @Desert Fox

    Of course I agree.

    But it turns out that some researchers have inspected many different vaccine vials of differing brands and found no MRNA whatsoever, only graphine oxide and heavy metals.



    Video Link

    • Replies: @Desert Fox
  165. geokat62 says:
    @Thomm

    Ron Unz has the look of a man who has realized that he lives in the exact epicenter of the tech industry, yet missed the greatest tech boom ever even as it happened all around him.

    Don’t underestimate Ron Unz’s entrepreneurial prowess…

    Excerpts from This Man Controls California:

    At the same time, some of Unz’s Harvard buddies had gone to Wall Street, where the Bonfire of the Vanities era was in full swing. At their urging, Unz looked for a summer job and caught First Boston’s eye in part by noting his IQ on his resume. What Unz thought would be a brief summer hitch in 1987 turned into six years in New York, the abandonment of his Ph.D., and the conviction that he could earn and save enough to pursue his policy passions independently…

    A self-taught programmer, Unz, then 26, wrote software that allowed cash flows from large pools of mortgages to be sliced up and profitably recast into new securities. These were the early days not only of such mortgage “securitization” but of desktop PCs powerful enough to permit such work to be done easily. Unz’s bosses at First Boston were thrilled. For Unz, the lightbulb went on: he could probably get rich if he perfected and sold such software on his own.

    https://www.mattmilleronline.com/articles/7-99-man-controls-california.php

    • Replies: @Johan
    , @Johan
  166. meamjojo says:

    Adults Aged 35–44 Died at Twice the Expected Rate Last Summer, Life Insurance Data Suggests
    September 6, 2022

    Death claims for working-age adults under group life insurance policies spiked well beyond expected levels last summer and fall, according to data from 20 of the top 21 life insurance companies in the United States.

    Death claims for adults aged 35 to 44 were 100 percent higher than expected in July, August, and September 2021, according to a report by the Society of Actuaries, which analyzed 2.3 million death claims submitted to life insurance firms.

    The report looked at death claims filed under group life insurance policies during the 24 months of the COVID-19 pandemic, from April 2020 to March 2022. The researchers used data from the three years before the pandemic to set a baseline for the expected deaths.

    While COVID-19 played some role in the majority of the excess deaths for adults over the age of 34 during the two pandemic years, the opposite was true for younger people. For people 34 and younger, the number of excess non-COVID deaths was higher than those related to COVID, the data show.

    During the third quarter of last year, deaths in the 25-to-34 age bracket were 78 percent above the expected level and, for people aged 45 to 54, 80 percent higher than expected. Excess mortality was 53 percent above the baseline for adults aged 55 to 64.
    ,,,,
    https://www.theepochtimes.com/adults-aged-35-44-died-at-twice-the-expected-rate-last-summer-life-insurance-data-suggests_4711510.html

    • Replies: @MarkU
  167. Johan says:
    @Thomm

    Those who only promote what is unpopular will never make such fortunes. Mister Unz deserves much credit for providing a platform for that.
    ‘Thought leadership’ is a contradiction in terms, thinking is individual or there is no thinking. Moreover, you are being lowly suggestive, like a man sniffing the lower end. Talking about a man’s ‘net worth’ is vulgar too, thus you appear someone who like to sniff at both the lower end and the vulgar, making it smelly around here. I’m sure you have a good chance of making a fortune out of that, it’s very popular.

  168. I would not take false confidence after taking vax that one has no complications. Independent biological researcher Robert O. Young reports that most of the initial vax vials are nothing but saline and only 2% have active spike proteins and graphene. But the booster odds increase to 25%. Think Russian Roulette.

    Frankly, it would be better to just detox your colon using MagnesiumO7 than taking a vax shot.

    Most respectfully, Unz is a believer in technology and thus has a proclivity to trusting the vax.

    From what I can find, no vaccine has every worked in history.

    The problem is sociological ignorance. Suggest reading sociologist Peter Berger’s book, The Social Construction of Reality: A Treatise in the Sociology of Knowledge.

  169. Tony Hall says:
    @cohen

    I’ve been watching the last two threads generated by RU’s ongoing self-justifications. I’ve been looking for any reference to the Lancet’s disastrous crash into academic publishing infamy. The editors at Lancet essentially did the equivalent of 1st degree murder in their fields by granting peer reviewed status to a totally cooked up piece of fraud said to be done by a fake operation known as Surgisphere.

    https://www.the-scientist.com/features/the-surgisphere-scandal-what-went-wrong--67955

    In the wake of this crime, the Lancet COVID Commission chaired by Dr. Sachs has about as much prestige as the process of stealing from the collective wealth shared by the Soviet people in order to give it all away to a few Jewish kleptocrats approved by fellow Jewish kleptocrats in the United States.

    The purpose of the Lancet fraud was to prevent hydroxychloroquine from getting any recognition which might have blocked Emergency Use Authorization from going to the extremely dangerous COVID jabs. Now the jabs are being pushed on kids with the goal that eventually the COVID shot makers will get permanent immunity from being sued. The requirement for this \$bonanza is that the jabs be FDA recommended for children.

    Lancet’s fall from grace was shared by the New England Journal of Medicine.

    Of course there is never any reckoning, so far at least, with the COVID crime spree. For those inside the power bubble, its like the Surgisphere hoax and other similar COVID scandals never happened. Mr. Uz is well in line with other self-aggrandizing schemers when he declares, “it was hardly surprising that the Lancet, a top medical journal, named him [Sachs] chairman of the Covid Commission.”

    Its time to start dealing with the role the criminal justice system should be performing in this ongoing fiasco which EU parliamentarian, Christine Anderson, refers to as biggest crime on humanity… ever. On “The COVID-19 Power Grab as Organized Crime,” see

    https://www.globalresearch.ca/covid-19-power-grab-organized-crime/5792651

    See also

    https://www.globalresearch.ca/covid-myths-explode-delusions-shattering-our-exit-from-subservience-leads-nuremberg-2-0/5789176

    • Replies: @geokat62
    , @cohen
    , @niceland
  170. Espace says:
    @jimbojones

    13 years with the company, zero deaths, ZERO!
    On a team of 13 people, the following;
    1 heart attack, wife found him on the kitchen floor
    1 cerebral hemorrhage, he made it to the hospital and later died
    2 (in their twenties) formally diagnosed with myocarditis
    They have all been diagnosed with #ABV ‘Anything but the vaccine’
    And yet, he continues the march.
    Perhaps it is Ron who suffers from media silence
    Thanks for your comments, agree

  171. Grant says:

    Ron, appreciate your work, and don’t be depressed about lack of bio-source coverage. Like JFK and 9/11, most thinking people, or anyone that gave it any thought, is aware of the ‘truth’ (or something closer to the truth than the official narrative) and has moved on to the next and most immediate threat. We will all die waiting for a mea-culpa from those responsible for any of these atrocities. Most revenge is left unsatisfied, unfortunately, ditto vindication – life ain’t Hollywood. ‘I live in the real world where stupid hurts’.

  172. geokat62 says:
    @Tony Hall

    Its time to start dealing with the role the criminal justice system should be performing in this ongoing fiasco which EU parliamentarian, Christine Anderson, refers to as biggest crime on humanity… ever.

    … and who heads America’s criminal justice system? Why, it’s none other than Merrick Garfinkel. Talk about the fox guarding the henhouse!

  173. Johan says:
    @Steve Naidamast

    As everyone is probably aware, the J&J vaccine was never really promoted and was allowed to slide into obscurity to the point that it is no longer producing it.

    After refusing vaccination for 1.5 year, I took a J&J to calm down my overly afraid germaphobe girlfriend (she being really worried all the time), avoiding the mRNA type of vaccination. In a few days I had a hoarse voice, flashes of dizziness, an ever increasing bad condition, fast heartbeat at rest, after three weeks I ended up, emergency case, in the hospital with hyper-thyroidism.
    Never seen a hospital, and hardly a doctor for somewhat over forty years before that, since I was twelve year old. Still on treatment.
    The doctor, upon being notified about the most likely causal relation said ‘well, it is impossible to find out’. How many people are there like that?

    • Replies: @Barbarossa
  174. It’s like 2020 election fraud. They tell us no credible evidence has been presented in a credible venue, but the correct telling of the story is that no credible evidence was allowed to be presented in a credible venue.

    BTW, it’s kind of strange that you dismiss the vaxx angle as a distraction from the real story, as it, like the origins, is a part of the bigger story that is in motion.

  175. Tsarlazar says:
    @jimbojones

    And today, though it’s beyond clear the experimental shots are completely useless, the unvaxxed in Canada still have to serve 14 days house arrest after returning from foreign trips and some (myself included) still cannot enter their work offices. Comically, our firm sent an email a few days ago alerting all employees to a covid outbreak among the vaxxed/boosted who are the only ones allowed in. For some reason, the powers behind the curtain aren’t ready to let go of the covid scam yet, at least until they’ve completed preparations to spring the next one on us. Because the majority submitted to the vaccine coercion, elites know future campaigns will be much easier to pull off, as the majority proved they’re timid and weak.

  176. Espace says:

    Mr. Unz, last time you claimed you were viciously attacked. I’ve been reading through the comments. You have certainly earned it this time. I don’t know what planet I’m on anymore. Anti-Vax: Hmm, 23 years of military service with every known thing they could inject a human with (including anthrax).

    Perhaps you are playing both sides of the fence. You want to blame the USA for the Covid origins ( (China hit first followed by Iran) and at the same time bless the vaccines, when the origins of both are one and the same.

    If you wanted to know the origins of COVID, you might start looking at the vaccine manufacturers.
    So, JFK could be an ‘inside job’, as well as 9/11, but not C19 vaccines?

    The origins of COVID lies in the origins of the vaccines themselves. The MSM mantra was that the Chinese gave us the sequence codes of COVID to develop a vaccine. That’s kind of hard to do for a virus that has not been isolated.

    Perhaps you should study the reason Moderna is suing Pfizer: For copyright infringement. Why? Because Moderna patented the ‘sequence codes’ in 2016……yeah, there’s no conspiracy there….

  177. lavoisier says: • Website
    @Not Important

    You are reading the website created by the Jew you disparage. The man who more than any other I can think of is risking his neck for the sake of free speech.

    Stop being such an ungrateful prick.

    I think by now whether you agree or disagree with Mr Unz you have to respect him for his honesty and courage.

    • Thanks: Rurik
  178. Rurik says:
    @Thomm

    His hairline alone is a disaster

    good Lord

    I think the word cretin would object to being associated with the likes of you

    Cretin: ‘oh no you don’t. I may be bad, but I’m no Thomm!

    • LOL: chris
    • Replies: @Mark Hunter
    , @Ron Unz
  179. A quick COVID anecdote, for what it’s worth.

    Pulled back into civilization. Central San Diego, late 2020.

    After barely surviving 4 years in the forsaken Sonoran Desert.

    Left behind a hangman’s noose, and decided to give life another chance.

    The unbreakable wild animals of that hell on earth had taught me some things about life.

    For one, they’d given me the courage to spit in the Grim Reaper’s face.

    Anyway, awfully beaten up, hobbled into the SD VAMC, to get patched up.

    Multiple surgeries for internal/external injuries, with time spent in ERs, ORs, and an ICU.

    From late 2020, all the way through late 2021.

    All as the MSM was pushing strange narratives of corpse-draped gurneys clogging hospital hallways.

    Scratched my head, wondering what planet they were reporting from.

    That hospital was really not much busier in 2021, than it was in 1991.

    Surely opened my eyes, to the fanatical propaganda that’s part of a creepy COVID tale.

    • Thanks: Rurik
  180. …and decided to give life living another chance.

  181. @Johan

    If you have the publication and page number for the Spencer report I would be keen to see exactly what the man said.

    I didn’t make my own judgment about the corona operation until after I had read a bunch of accounts of historical epidemics and reactions and I missed that one which might have saved me substantial work if I had it at the right time.

    • Replies: @Johan
  182. Let us ask…

    1) How does a 2016 Moderna patented sequence make its way into the COVID 19 strain?

    2) How do we know that the outbreak in Qom Iran was connected to China instead of a separate attack?

    3) How do COVID 19 antibodies end up in stored Norwegian blood samples prior to the outbreak?

    4) Why is there express specific hostility against Stromectol/Ivermectin as an anti-viral success story even when found for the last 25 years in a Physicians Desk Reference for human use?

    5) How does Steve Bannon figure the overthrow of the government in China in June 2020?

    6) Whatever happened to the Diamond Princess snot barge?

    • Replies: @A123
  183. @H. L. M

    Thanks, the majority of people can not comprehend how evil these creatures are that are behind the depopulation genocide of the planet, I call them creatures as they are not human, they are some of the most demonic, diabolical, draconian creatures that this world has ever seen.

    • Replies: @geokat62
  184. geokat62 says:

    Telegram comment posted by Dr Roger Hodkinson:

    The site GoodSciencing. com has been cataloging all sudden deaths of athletes from around the world since the COVID vaccines were rolled out.

    So far they have accumulated nearly 900 sudden athlete deaths in the past 20 months (~540/year and growing).

    They include several other studies from various institutions showing the normal athlete sudden death rate average before the vaccines was ~29-66 per year.

    The full list of deaths can be found here:
    https://goodsciencing.com/covid/athletes-suffer-cardiac-arrest-die-after-covid-shot/

    Join 👉 https://t.me/RogerHodkinson

    https://t.me/RogerHodkinson/536

  185. MarkU says:
    @meamjojo

    In the UK (non-Covid) excess deaths are running at 1,600/week above the 5 year average for the time of year, similar figures have been reported from Australia.

  186. geokat62 says:
    @Desert Fox

    I call them creatures as they are not human, they are some of the most demonic, diabolical, draconian creatures that this world has ever seen.

    Well said. And among the most diabolical of creatures must be counted one Dr Eric Rubin.

    Dr. Rubin is no ordinary doctor, he is also the Editor-in-Chief of the New England Journal of Medicine.

    Buried 6 Hours Into FDA Video: Doctor Makes Chilling Admission on Child COVID Vax

    Starting @ 6:51:00, here’s what came out of this creature’s mouth:

    We’re never going to learn about how safe the vaccine is unless we start giving it [to little children], and that’s just the way it goes. That’s how we found out about rare complications of other vaccines.

    • Replies: @Desert Fox
  187. lloyd says: • Website
    @allergic2katz

    You have a one in a thousand chance of dying after been bitten by a deadly venomous snake in your bedroom if someone puts it in your bedroom.

    • Replies: @allergic2katz
  188. MarkU says:
    @meamjojo

    Perhaps you missed this…

  189. Johan says:
    @Emil Nikola Richard

    In the case of Spencer, it is not a comprehensive report, it points to reports which were made at that time (late nineteenth century). Spencer’s works, as a radical classical liberal, are dedicated to showing how incompetent governments are, and how misplaced their policies in general always are. I believe it was in either ‘The Study of Sociology’ or ‘Social Statistics’.
    But there are books from other writers which are specially dedicated to the debunking of the alleged positive effects of vaccination policy, with much more elaborate reports.

    A nice anecdote: Spencer writes about the situation that activists were claiming that the amount of cases of syphilis were rising drastically, but various doctors and also an expert on syphilis claimed that they knew nothing of a rise in cases. Still the activists managed to convince the government, and a special policy was created.. Governments mostly live in an illusory reality. Truth is of the individual.

  190. @allergic2katz

    That’s a loaded analogy, because you can’t compare Sars-Cov-2 (fatality rate of around 0.1%) to a deadly venomous snake in the bedroom. At least, not in good faith.

    The topic is not fatality rate but what you labelled as psychological operation which you assumed that Ron Unz was incapable of grasping. I was trying to demonstrate to you that psychological operation and physical threat could come together. That takes us to your next statement which I believe is incorrect.

    Bingo. And the fact that Ron Unz can’t (or won’t) grasp this suggests something nefarious about his motives in continually pushing this particular angle.

  191. @geokat62

    Thanks, agree, these creatures are demons from the depths of hell.

  192. jimbojones says: • Website

    Couple of more points:

    (1) Regarding the origins of Covid, I’m on the record on this site stating I believe that in a saner universe, Unz would merit a Pulitzer nomination for his Covid origins work. It is an important issue and he figured out most of it very early. Yes, elements of the US establishment released Covid. They did it in China, because it was easier to conduct the research there and because they could then hoodwink gullible conservatards (and many libtards) into hating on China, which is #2 priority nowadays after hating on Russia. Covid was not an attack on China, it was an attack on the global population. The virus was the pretext and the real weapons were the lockdowns and the syringes. We have the bulk of the remaining pieces of the origin of Covid story in the Mercola, Breggin and RFK Jr. books.

    So even though many of us disagree with Ron on the issue of the vaccines, many of us are also grateful to him for his work on the origins of Covid and for creating this great forum, one of the best on the Net over the last 10-15 years.

    The reason people focus on the vaccine mandates instead of on the Covid origin is that the Covid origin issue has been solved, while the mandates and syringes continue to wreck lives.

    (2) Regarding evidence of the vaccine failure: At this point asking for evidence about this is like asking for evidence that men are different from women. The evidence is all encompassing, it takes heroic effort not to see the evidence. Nevertheless: Unz himself presented the easiest to read evidence in the last article. It’s the overall mortality. Quoting from the CDC: “The overall age-adjusted death rate increased by 0.7% in 2021 from 2020.” Since mass vaccination started in January 2021 and everyone who wanted to get vaccinated did so by the mid-summer, the increased overall mortality means that (a) the vaccines don’t work in any meaningful way; and (b) the vaccines likely killed at least some thousands of people.
    https://www.cdc.gov/mmwr/volumes/71/wr/mm7117e1.htm

    But if the obvious is not enough and one insists on The Science, here is one of today’s headlines over at The Revolver: “‘Unethical’ and up to 98 Times Worse Than the Disease: Top Scientists Publish Paradigm-Shifting Study About COVID-19 Vaccines”
    https://archive.ph/MoP0V

    A team of nine experts from Harvard, Johns Hopkins, and other top universities has published paradigm-shifting research about the efficacy and safety of the COVID-19 vaccines and why mandating vaccines for college students is unethical.

    This 50-page study, which was published on The Social Science Research Network at the end of August, analyzed CDC and industry-sponsored data on vaccine adverse events, and concluded that mandates for COVID-19 boosters for young people may cause 18 to 98 actual serious adverse events for each COVID-19 infection-related hospitalization theoretically prevented.

    McCullough can and frequently does roll out dozens if not hundreds of other studies that reach similar conclusions. Note that going against the grain in The Science nowadays can be costly. McCullough has been removed from a myriad of posts he held only two years ago. It takes courage to publish these studies.

    • Replies: @geokat62
    , @Ron Unz
  193. “At 50, everyone has the face he deserves.” These are George Orwell’s last known words.

  194. @Jeff Davis

    I agree. And if every third grandmother had died within a week of getting the jab, people would have made up their minds, media distortions or no. The vaccine movement itself would have quickly died.

    In time, the mRNA vaccine will have a net deleterious effect on everyone taking it. Most such effects – this being unquestionably and specifically by design – will express most profoundly and visibly over the medium and longer term. However, according both to variation by vaccine batch as well as recipient propensity and predisposition to the fundamental process(es) provoked by the jab, the ultimate level of harm has yet to be measured.

    In the short term (ie., with “temporal proximity”), some recipients will indeed succumb to acute inflammatory processes induced by the vaccine. In the medium term, we will continue to see increases in cancers emerging from remission, neoplasms (some extremely aggressive), and suspected cases of infertility. In the longer term, the worst will arrive: prion-related neurodegenerative disease.

    Strangely, many people who agree that a virus with very low lethality might nevertheless constitute an engineered “bioweapon” will not accept that a vaccine not killing all who receive it within 24 hours could also be a bioweapon. The fiends who developed both the SARS-Cov-2 alarm bell and the mRNA vaccine as response are psychopathic misanthropes, but in terms of the psychological assessment of their prey, they are most assuredly not stupid.

  195. Jonny C says:
    @Stephane

    While it may be possible to create an mRNA vaccine more quickly than a traditional vaccine, let’s remember how this played out and think about it for a second.

    There was no organic process of looking for a cure. In fact, cheap and effective drugs were removed from the running and doctors who had been treating covid with Ivermectin and others were dismissed. That means that the narrative was set in advance, and pushing the vaccines were part of the narrative. In an organic health crisis, the research of ALL doctors treating the disease would be considered. In a pro-vaccine campaign (Like H1N1 to a lesser extent) other ways of dealing with the disease are invalidated by the media. This takes a lot of cooperation and planning, and it should be apparent in hindsight that this is what happened.

    In fact, the deplatforming was already planned ahead of time, which is also made clear by Event 201. The fact that every alternative media platform that did not become part of the controlled opposition was removed from social media was not accidental. The narrative was that you will be saved by an effective vaccine from this novel virus that mutated in bats. The narrative was a lie, both parts of the narrative. Ron Unz and others have demonstrated that the virus likely came out of a lab. The second half is that pushing these harmful vaccines was part of the plan, right from the very beginning.

    Some of us were fooled once, others twice. The “anti-vaxxers” may have been fooled… but not twice.

    • Agree: Mark G.
  196. geokat62 says:
    @jimbojones

    McCullough has been removed from a myriad of posts he held only two years ago. It takes courage to publish these studies.

    It does, indeed.

    Telegram comment posted by Dr Peter McCullough:

    So honored to receive the “Humanitarian Award” from a major medical society today. Second such award in their 38 yr history. Thanks IAOMT for taking the lead on patient autonomy, medical freedom, and innovation in pandemic response.

    Join 👉 @PeterMcCullough

    https://t.me/PeterMcCullough/2049

  197. Anonymous[102] • Disclaimer says:

    A command by Russian President Vladimir Putin could annihilate the bulk of America’s population in less than an hour….

    Mr. Unz. Ukrainians report that sixty percent of Russian bombs, artillery shells etc failed to explode. And today the world has learned nthsy The Russians are in humiliating retreat…. The mighty Russian power is a fable

    • Agree: meamjojo
    • Replies: @Biff
  198. Anonymous[102] • Disclaimer says:
    @meamjojo

    Unz is a neo fascist supporter of putin and “Christian Russia”. Today Russia’s invading forces are in full retreat and Unz and others like him will eat their words.

  199. Mark Hunter says: • Website
    @Rurik

    I agree.  (I don’t comment frequently enough to be able to use the AGREE/DISAGREE/ETC. button at this point.)  RU probably gets a good laugh out of such bile as Thomm’s assuming he reads beyond the first insult.

    • Agree: Rurik
  200. Anon[357] • Disclaimer says:

    No matter how long Ron continues to beat his drum of a rogue biowarfare mission, unless he brings some evidence to the table, which he has already demonstrated beyond any doubt he is incapable of offering, this whole narrative is just a ridiculous conjecture. As to what Glenn Greenwald and Tucker Carlson think: My god, could the horse and cart get more totally turned around and falling off a cliff while pirouetting? The comments here are proof of the nothing burger of this theory, with every whackadoo chiming in with his pet grievance. This whole concern is Onion comedy with no punchlines, satire read literally. This forum is intellectual dirt farming where 1000 lost USA libertarians gather to out gripe each other about the the eternally unprosecuted malfeasance of their lost daddies. The only thing that’s not going on here is anyone working together to discover anything. It’s just screaming orphans.

    There’s a clear way out of all of this Unzian bullshit: find any shred of actual evidence that’s not de-contextualized hearsay!

    Sure everything Ron projects could be true. The only thing that’s missing is any direct connection between all his speculations and reality. And as long as there’s no direct connection, you’re stuck with the hard fact that you don’t actually know anything!

    As to why the MSM is not giving Ron’s fantasies a lot of coverage… He genuinely thinks the role of the fourth estate is to probe his dreamlife and follow it to the ends of the earth? If Ron owned the NYT, can you imagine him following any of his commenters wild assertions down the rabbit hole?

    Ron has purvey over a forum that can give life to any radical claims he chooses. Go ahead, publish the dirt! But instead he just amplifies Tucker Carlson’s luntatic raving as if Fox News is not already one of the biggest bastions of airheads with criminal purposes on the media landscape.

    It’s crazy town.

    But I’ll keep checking in because Ron’s earnestness wins me over. He has to be sincere, because this outlet is too dumb and shaggy to be a ruse.

    • Agree: meamjojo
  201. Ron Unz: “The Wuhan lab probably had nothing to do with Covid, and there’s ZERO evidence of any lab-leak.”

    Some would say this is evidence:

    https://www.nbcnews.com/health/health-news/u-s-intel-report-identified-3-wuhan-lab-researchers-who-n1268327

    Ron Unz: “According to these multiply-sourced mainstream media accounts, by “the second week of November” our Defense Intelligence Agency was already preparing a secret report warning of a “cataclysmic” disease outbreak taking place in Wuhan.”

    A lab leak at WIV might have been seen as “cataclysmic”, especially if it were known that GOF research was what they were working on.

    It reminds me of the plot of the 2002 movie “Resident Evil”, and maybe it had the same effect on whoever it was that prepared the report. “Lookout folks, it’s zombie apocalypse time! The T-virus has escaped!” LOL

    • Replies: @Ron Unz
  202. Johan says:
    @geokat62

    Mister Unz does not appear to be your average luxury-proletarian (democratic man). I appreciate that. Men of culture, and men of conviction do not bother themselves with futilities.

  203. Paul C. says:
    @Kevin Barrett

    The anti-vax movement is wide awake and has been. It’s folks like Ron Unz who haven’t a clue. Vaccines are harmful. End of story. Here’s some data to consider.

    https://odysee.com/@ChristopherKennethBowser:6/Vaccinated-Children-Data-Vs-Unvaccinated-Children-from-birth:8

    https://www.doctorsandscience.com/presentations.html

    Research Dr. Andrew Moulden for incontrovertible evidence.
    https://vaccinepapers.org/dr-andrew-moulden/

    Big Pharma, the media, the WEF, the WHO and the governments are controlled by the same folks, the (((owners))) of the Central Banks. The ones pushing White Supremacy, war, and mandatory injections, while looting taxpayers through “aid” to Ukraine.

    Interestingly the injection has little effect on the Ashkenazi bloodline.
    https://stateofthenation.co/?p=121832

    But I know it’s anti-semitic to reveal the truth. Even though they’re not even semites. And who knows how this cocktail of injection nano particles (graphene oxide /hydroxide) and 5G will affect the human race.

  204. Jonny C says:
    @Wild Man

    I would give Unz the benefit of the doubt that he is acting in good faith. I was unhappy about his unwavering support for the lockdowns. His dismissal of the evidence that the vaccine pushers were making Covid out to be more virulent than it was was also disheartening. On the other hand, I was skeptical about the lab story at first, and now I am convinced. “We can’t be right all the time. Nobody’s perfect.” (A Christmas Carol)

    As I have said before, nobody knows everything at the beginning. It takes time, and a lot of reading of various perspectives to arrive at the truth of a matter. That being said, a great deal about the vaccines has been published by the Unz Review. I do imagine that Unz reads his own website. That he continues to dismiss the evidence that the vaccines are harmful and ineffective is surprising. Why, light of such evidence, he uses polemical phrases about the anti-vaxxers, as if they acting out of some unfounded superstition, when in fact the evidence is sufficient, raises some questions.

    It is said by the behavioral psychologists that when you do something, you will justify it. Anyone who has taken the vaccine doesn’t want to admit that they took the wrong road, and perhaps that alone is sufficient to dismiss evidence that they actually injected themselves with a pathogen.

  205. niceland says:
    @Steve Naidamast

    However, Jeffrey Sachs, an economist by training was the only person to request investment assistance to the former Soviet Union after its collapse and was completely ignored by the US neoconservatives who were given license to plunder the dying Russian state.

    As Naomi Klein reported in her excellent book, “The Shock Doctrine”, Sachs was not a part of the neo- conservative rape of Russia but has been blamed for such.

    That’s interesting, thanks!

    Listening to Sachs describing his experience in the covid commission is incredible. Members of the commission lying to him, trying to hide or distort facts and the overall lack of will to dig deep (and discover the truth!?). This just can’t be ignored unless one believes Mr. Sachs has zero credibility.

    For whatever reason I see comments denigrating his credibility; he is just economist and no doctor or expert in the field of viruses, he is the guy that wrecked Russia in the 1990’s and so forth.

    Well, even if he did try to wreck the Russian economy (he didn’t) this could not explain why he is now making false claims about his experience in the search for the origins of covid . And anyone who has been around the block a few times can tell if they are being misled or lied to – from time to time at least – economists or not. His words should raise eyebrows to say the least. .

    The silence in the media is perhaps telling. Because Mr. Sachs is, or was, their guy so to speak. He is Internationally “respected mainstream figure”. Even I am familiar with his name, just by reading local economists (former IMF employees) in the past. I think this is the reason why he was chosen to lead this commission, to provide credibility. When he suddenly goes on a rampage telling extraordinary tales of what he has encountered and what he believes – this poses a major problem. If the media reports what he is saying the cat is out of the bag because Mr. Sachs has way too much credibility to be ignored.

    This is why it’s much safer to print at length articles about the Russian allegations because according to the official narrative; they are pathological liars. It’s not only safer, it’s a clever tactic, because all the “normies” reading the NYT article walk away with the idea that all talk about covid being created in or by the U.S. or being a bio-weapon or whatever – is just Russian propaganda. Nothing to see here, just move along!

    The alternative media really has to take a much closer look at Mr. Sachs story.

    • Replies: @Wizard of Oz
    , @A123
  206. Richard B says:
    @Carlton Meyer

    spending many tens of billions of dollars to wage a deadly proxy-war on Russia’s own border.

    They’re doing a variation of that theme on the US border. Proof that the Invite-Invade-In Debt to the World template of their Domestic, Foreign, and Economic Policies that, along with their Divide and Conquer (and Corrupt and Conquer) is essential for their goal of Full Spectrum Dominance, is being aggressively applied without correction to the world they long to control.

    Which means they’re operating in the realm of the aboslute. With rather disagreeable, but totally predictable consequences. In short, Jewish Supremacy Inc. has totally lost it.

    And I say Jewish Supremacy Inc. because of all of the individuals and groups that make up the hostile elite, they are the only ones who are completely above criticism.

    Meaning, they could even criticize their own Golden Children, so to speak, (LGBT, blacks, Islam, China, etc, ie; Identity Politics) if they thought it was necessay, but none of their Golden Children can criticize them and get away with it. And that goes double for their Designated Scapegoat – Whites. In fact, more than double.

    Dr. David Martin, a prominent and influential anti-vaxxer, warned that up to one-third of the American population would soon be dead from vaxxing, and demanded Nuremberg-style tribunals for those responsible for this looming disaster.

    Nuremberg-style? You sure about that?

    If he is sure then he’s obviously calling for a tribunal where everything is seen exactly as it is not. Thereby making him the literal definition of controlled opposition.

    In any event, Nuremberg-style = Victim Blaming Tribunal.

    In short, their bold inversion of reality. Which, of course, is what our teaching-learning institutions have become, a Nuremberg-style Bold Inversion of Reality. Hence JSI’s need to completely rewrite history. So, be careful what you wish for Dr. Martin.

    But I’d like to believe that once there is a major breach in the dam, an enormous flood of long-avoided information will soon flow outward.

    Me too.

    But it’ll never happen unless we also address the Nurember-style/Victim Blaming Tribal-like control of all information. Until that happy day, arguably the two most important consequences of their control – Cultural Impoverishment and Societal Collapse – will continue.

    And since we’re living at a time when things are happening so fast, time is running out and we’re working against the clock. In fact, we’re hardly working at all. But they are. And all of their considerable energy is geared toward one thing – destruction.

    From this perspective Full Spectrum Dominance is really Full Spectrum Destruction.

  207. cohen says:
    @Tony Hall

    I have lot of respect for Ron and for his efforts.
    Then Jeffery Zachs started appearing in Ron well researched articles. A quick search of less than two minutes exposed scam. Two magic words Economist and Sustainable Development were enough for me.
    I looked at Lancet Covid Group and found most of them are economists, psychologists, including a librarian. And these commission are issuing decree on bio weapons. you got to be kidding me? right.

    I remember in one EPA’s rule making committee on cigarette emission (particulates) we had an economist from Duke Energy. He was just a warm body. I heard he bulldozed his way through and appeared in a congressional hearing as a witness/expert?.

    And folks any time you see UN and the World Bank getting involved in NGOs alram bells should go on in your head. Free loading and riding the gravy train.

    • Replies: @Ron Unz
  208. Ron Unz says:
    @Dr. Robert Morgan

    Some would say this is evidence:

    Not really. Pompeo’s people just gave the MSM an unsubstantiated, third-party intelligence claim that three Wuhan lab researchers had fallen ill with Covid-like symptoms. The big story reporting that was in the WSJ by one of the same reporters who’d co-authored all the Saddam WMD stories a couple of decades earlier. As I wrote:

    This situation carried disturbing echoes of how those same mainstream media organs had played a similar role twenty years ago in fostering the hoax of Saddam’s WMD and promoting our disastrous Iraq War. Indeed, I found it rather ironic that one of the main Trump Administration Covid experts quoted in that article and others was David Feith, whose father Douglas Feith had been one of the leading Neocons involved in that notorious Bush Administration intelligence fraud. Moreover, the lead author of the front-page Wall Street Journal story that helped to revive the lab-leak theory in late May was Michael R. Gordon, who had previously shared a byline with Judith Miller on most of the fraudulent Iraqi WMD stories that had propelled us into war. And in early 2020, former Mossad agent Dany Shoham had been one of the earliest figures suggesting that Covid was a Chinese bioweapon leaked from the Wuhan lab, with few remembering that in 2001 he had falsely fingered Saddam’s regime as the source of the Anthrax mailings. It almost seemed that members of the old Iraqi WMD cast were reassembling for a revival.

    https://www.unz.com/runz/american-pravda-the-covid-epidemic-as-lab-leak-or-biowarfare/#the-alleged-wuhan-lab-leak-and-its-scientific-skeptics

    The best Western eye-witness was veteran Australian virologist Danielle Anderson, who was working at the Wuhan lab at the time. She said the safety precautions were outstanding, no one became ill, there wasn’t any sign of a leak, and she very much doubts that Covid was developed there. That trumps an anonymous leak by Pompeo’s henchmen.

  209. @Franz

    Yes, he needs to reconsider the jab. I personally know two people who suffered coronaries within a day or two of the jab, although they got prompt medical care and survived. But I also have friends who lost loved ones (two) shortly after the jab, one a healthy man in his forties and the other a healthy man in his seventies. If you answer these four cases are coincidences, I would say that is possible but highly unlikely. If the vaccine were safe and complications as rare as claimed, me, just an average guy, would not be aware of at least 4 serious complications, two of which were fatal, directly following the jab. If complications were very rare, it would be very rare for someone to even know of a single complication. I imagine many here could verify my casual observations with their own observations.

    I think Ron will come around. While he understands that the media can be co-opted for purposes of control, it’s a more difficult step for someone to come to the conclusion that even medicine and science can be co-opted for purposes of control, especially for someone that holds the empirical method in high esteem, which I imagine he does (I do as well). Nevertheless, sooner or later I believe he will get there, especially if those opposing vaccination dial down the ignorant and shrill comments. FYI I felt your comment, and I hope mine as well, was measured and dispassionate.

    • Replies: @Franz
    , @mike99588
  210. Ron Unz says:
    @jimbojones

    Thanks for the kind words.

    (b) the vaccines likely killed at least some thousands of people.

    I’d certainly agree with you about that and have repeatedly said so. It’s even quite possible that the American vaccine death toll has been in the tens of thousands.

    However, I do accept the claims that getting vaxxed enormously reduces the likelihood of serious Covid illness or death, so the cost-benefit ratio is strongly positive for anyone older than about 40-50 or so. On the other hand, the currently dominant Omicron variant is very mild, so vaxxing is no longer nearly as obviously beneficial as it might have been last year.

    • Agree: Wizard of Oz
    • Replies: @Random Anonymous
  211. JimmYee says:
    @Thomm

    Any decent person would be ashamed of such a garbage post, Thomm.

  212. Ron Unz says:
    @Rurik

    I think the word cretin would object to being associated with the likes of you

    I wouldn’t be too hard on poor “Thomm.” He’s just a notorious Hindu immigrant troll who hangs around here.

    The reason he’s so ticked off at me is that he was pretending to be a white American, but doing so in such a ludicrous manner that I ridiculed him for it. Anyone can look at his Commenter Archives and see what I mean:

    https://www.unz.com/article/what-i-learned-about-race-as-a-cop/?showcomments#comment-5430472

    • Thanks: Rurik
    • Replies: @Thomm
    , @Rurik
  213. niceland says:
    @Tony Hall

    In the wake of this crime, the Lancet COVID Commission chaired by Dr. Sachs has about as much prestige as the process of stealing from the collective wealth shared by the Soviet people in order to give it all away to a few Jewish kleptocrats approved by fellow Jewish kleptocrats in the United States.

    The purpose of the Lancet fraud was to prevent hydroxychloroquine from getting any recognition which might have blocked Emergency Use Authorization from going to the extremely dangerous COVID jabs. Now the jabs are being pushed on kids with the goal that eventually the COVID shot makers will get permanent immunity from being sued. The requirement for this \$bonanza is that the jabs be FDA recommended for children.
    Tony; Let’s assume your take on the Lancet is more or less correct.

    How does this explain Mr Sachs testimony about his experience as head of the committee? Why is he telling us about the dishonesty, lies and dubious behavior of the members and airing his opinion covid was created in or by the U.S? How does this serve Lancet, it’s handlers or owners, sponsors? Or Mr Sachs himself for that matter?

    Fill me in – I don’t get it. The alternative – Mr Sachs telling the truth makes much more sense to me.

  214. Steve Sailer, Ron Unz, and Scott Adams walk into a bar…

  215. Ron Unz says:
    @cohen

    Then Jeffery Zachs started appearing in Ron well researched articles. A quick search of less than two minutes exposed scam. Two magic words Economist and Sustainable Development were enough for me.

    I’m not too familiar with Sachs’ policy positions in those various areas and I’m sure I’d disagree with many of them. But that’s not the point.

    Sachs is an absolute pillar of the elite academic establishment and as ultra-respectable as could possibly be imagined. That’s why he was named chairman of the Covid Commission.

    So when he says there’s a gigantic cover-up of the true origins of the Covid virus, it’s not me or you or even some random researcher saying it, let alone a conspiracy-nut. It’s the chairman of the Covid Commission. That’s the reason the MSM is going all-out to prevent people from hearing about him.

    If the alt-media heavily covers Sachs, it will put a great deal of pressure on the mainstream media to do the same. And if the MSM starts featuring Sachs, I think the whole cover-up may collapse and the floodgates will open.

    Suppose that Earl Warren had begun a national speaking tour in 1964 saying that the Warren Commission report was a whitewash and that JFK had been killed in a conspiracy. It’s potentially that big. Sachs is the lever that can be used to pry the doors that the Establishment is trying to keep closed.

    I’m friendly with some of the key people on the whole issue, and they were extremely impressed with what Sachs said in those interviews:

    https://www.unz.com/runz/prof-jeffrey-sachs-on-the-covid-origins-cover-up/

    My views are identical to those of Niceland upthread:

    https://www.unz.com/runz/covid-and-the-political-bankruptcy-of-the-alternative-media/#comment-5542617

    • Replies: @Wizard of Oz
  216. I need to get a comment in before I can Agree again with several good comments, so I’ll add this. Maybe someone has already pointed this out in a comment, there are 200 comments already, but this passage jumped out at me. The general point is nothing anyone hasn’t pointed out in many other places, though. Indeed, I’m sure Ron had the bracketed parts in mind as he wrote this (those parts added by me):

    Yet oddly enough, while most of our [Jewish-led] mainstream media routinely castigated and condemned Reagan for his occasionally harsh rhetoric against our [Jewish-inspired] Communist Russian adversary, today virtually all of our [Jewish-led] major media regularly spews forth vastly harsher condemnations of [note:] Christian Russia and its leadership.

  217. Johan says:
    @geokat62

    I started meeting politicians and found they were incredibly mediocre (Mister Unz)

    Really? they are after all the representatives of the public, of King People, so they cannot represent anything other than utter mediocrity. Actually all the institutions, as far as they contain representatives of the people, are peopled by mediocres. But politicians, being directly chosen by the people are the worst, they talk the clichés of the people the whole day, and execute their cliché agenda’s the whole time, that is, if they are not cynically opposing them and are pushing the interests of their own class, a class of representative mediocres.
    If you go out on the streets, chances are much better that you may meet someone clever, authentic and unique, while officially just some average guy, but among the political class, the chances are very very slim. King People, the democratic masses, really utterly hate anything brilliant, unique, and above their level, the mediocres at the political institutions are their cordon sanitair of mediocrity.

  218. Vidi says:

    Possibly a major reason for the silence of the alternative media is that many of these sites committed themselves to blaming China for originating Covid-19 (“the China virus”, “WuFlu”, etc.)

    These sites are therefore reluctant to admit they were probably wrong. Thus they ignore the stories that might embarrass them, such as Jeffrey Sach’s bioengineering claims and the even more embarrassing Russian evidence that Covid-19 came not from China but from the US — the home country of many of the sites that eagerly promoted the WuFlu story. Hence dead silence from alternative media sites.

    However, the Soviet Union also had extremely tight clamps on its media, arguably tighter than the vise now gripping the American media. Yet the Soviet underground information network, the Samizdat, is considered a major reason for the Union’s crash. Perhaps the US will experience something similar. The Soviet people used to say “There is no truth in Pravda”; many people in the US are asking “Where are Saddam’s WMDs?” and saying “There are many lies in the New York Times”.

    Of course, a massive revolution will probably be needed in the USA. The Russians’ dumping of the Soviet Union benefitted them (eventually); the Americans’ dumping of their one percent will likely benefit them too (eventually).

    • Replies: @d dan
  219. @Ron Unz

    Just because I suspected you of description creep I sought to check on your use of the word “veteran”. What I did find was

    Dr Anderson is sticking by her belief COVID-19 has a natural origin, saying: “The reason I think the virus escaping from the lab is a less likely scenario is if we look in the last 50 years, so many of the diseases and outbreaks that have happened have come from animals

    That was in the Sydney Morning Herald of Jily 4, 2021

  220. Biff says:
    @Anonymous

    Mr. Unz. Ukrainians report that sixty percent of Russian bombs, artillery shells etc failed to explode.

    The Ukrainians will report whales lay eggs if it supports their cause.

    • Replies: @Anonymous
  221. @SunBakedSuburb

    I don’t understand how Mr. Unz can assert that US government is evil enough to unleash Covid 19 on the world (which may be true), but that people who are skeptical of the government mandated vaccines are nutjobs.

    It seems to me that it is prudent to keep an open mind on both the origin of Covid 19 and the possible negative effects of the forced vaccines.

  222. @Johan

    I think that there are a lot out there. Sadly though, as you found out what is not looked for will not be found. As with others here, I know many people that have developed strange health issues after the Covid vaccination. Correlation is not causation…but still it’s very strange.

    Anyhow, I’m sorry to hear about your own health issues. I hope it improves.

  223. @Thomm

    You can disagree with a person without personal attacks. I would bet my meager life savings that Mr. Unz has achieved far more in his life than you could ever imagine.

    I don’t agree with everything Mr. Unz writes, but I am thankful to him for providing this forum. Issues can be discussed here that are forbidden in 99% of media sites.

  224. So it may be easier and safer for journos to concentrate on the vaccine story than to worry about the origin story. Got it. But I think that the one is walking and the other is chewing gum. I don’t think that seeing the virus as a military weapon and the vaccine as a dangerous experimental poison is a problem. I think that many governments fall under the “banality of evil” banner in that most of them will not hesitate to sacrifice X amount of citizens if it suits their agenda. Alternatively, there could be no connection between the virus modifiers and the mRNA tinkers and each would still be dangerous to humanity. Why does believing one have to mean you exclude the other? I will never understand.

    • Agree: Mis(ter)Anthrope
  225. @Ron Unz

    From your article

    Russia’s nuclear arsenal of nearly 6,000 warheads is just as formidable as our own, and its revolutionary hypersonic delivery system far superior

    On the evidence of the last six months in Ukraine it is surely probable that the 6000 include some that are missing (maybe sold in whole or for parts) and many that have been so lacking in maintenance that they are far from formidable. And what reason have you to believe that Russia had superior hypersonic delivery systems capable of what you describe?

    I would also challenge the worth of any belief in Russian statements about bio weapons or labs in Ukraine. What reason have you for ANY positive belief in self serving accusations by Russia or Russian officials?

    And while I am at it. Here’s something to help you catch up with Slavic reality (except his references to genes)

    I hope to get round to weaning g you off the rubbish about Nuland, McCain and other clowns pulling off a coup in Kyiv.

    • Thanks: meamjojo
  226. Thomm says:
    @Ron Unz

    As usual, Ron Unz is lying, as elsewhere he admitted that he spread this rumor only to see if he can get his lab rats (how he describes his WN commenters) to believe anything.

    He is going off of about 10 comments I made over 4 years ago, and ignoring the other 2500+ since then that could only have been made by a white American (and certainly not things a South Asian immigrant would say). Surely, he is not stupid enough to do that, so that means he himself does not believe it.

    But then again, Ron Unz is infamous for making comically inaccurate conclusions based on his emotional baggage. This is just one of half a dozen instances we could cite. Heh heh

    Not just that, but I called Ron Unz’s bluff. I gave him a challenge back in July :

    But I will take it one step further. I am one of the most valuable commenters on this website, when you consider what the true purpose of this website is. Ron Unz secretly agrees, but is hoping his intended targets don’t find out.

    If Ron Unz disagrees, then I insist that he not just ban me, but retroactively delete my entire comment history (over 2500 comments). I will agree never to comment here again under any other handle (and certain terminology I use will not appear under any other handle).

    If I am a ‘troll’ here, I insist that all comments I ever made be deleted, and I be banned from future commenting. He could do it with a push of a button.

    https://www.unz.com/article/what-i-learned-about-race-as-a-cop/?showcomments#comment-5430767

    RUnzie Baby definitely saw my challenge, as I posted it multiple times and many people urged him to do what I dared him to. But he did not. That offer was valid for seven days, and he let it expire.

    He would have to pay a troll to do what I do for free, so my commenting here saves him money (remember the true purpose of this website).

    That pretty much calls his bluff. He is heavily dependent on my continued commenting here, and sure as hell can’t afford for me to leave. It is super-easy to figure Ron Unz out.

    In the future, I will issue the same challenge again, to prove my point again as needed.

    Heh heh heh heh

    • Troll: Ann Nonny Mouse
    • Replies: @Astuteobservor II
  227. @niceland

    Indeed the lying to Sachs is enough reason to pursue investigation further. But let’s not get too excited. There was plenty of reason for embarrassed cover up without anyone even thinking of bio weapons.

    • Agree: JackOH
    • Replies: @mulga mumblebrain
  228. Balaji says:

    @Ron Unz

    Have you considered going on Joe Rogan’s or The Dark Horse podcasts. Both of them believe that Covid is an engineered virus. However they think that there was a lab leak not that it was a bioweapon. I fear that even they may find you too controversial.

    • Replies: @Ron Unz
  229. refl says:
    @Ron Unz

    I am honestly lost in this discussion. I have stopped believing in the virus on march, 15th 2020, I have warned every person that I could possibly reach out to about the vaccination (so called), though I certainly was never anti-vaccination in my life. I have made enemies.

    I have known from the start that the next stage would be war with Russia for the simple reason that politicans ecerywhere – and foremost in the West – are in urgent need to cover up their disastrous failings.

    I have found myself proven right at every turn, though I would love to be proven wrong. I have had this disease twice already and it was nothing. I know victims of the vaccine personally.

    I will grant that there are these American bioweapons labs. What they do, I cannot estimate, because I lack any expertise.

    I do not understand, where this death toll of 18 mio is supposed to come from. For what I know, the numbers never made sense from the start. But this discussion is old stuff.

    There now have been various well written articles about piggy-backing on minor conspiracies to pull off something big (JFK, 9/11).
    Maybe, this thing here goes in that direction?

    Would make sense to me.

  230. IreneAthena says: • Website
    @jimbojones

    Of course we are militant. — jimbojones

    If by “militant” you mean, we’ve had it up to ^ here ^, and we support legal means to get justice for all the victims of the Covid19 disease-shutdown-mandates-mRNA “package,” then yeah, okay, I agree totally, but “militant” is such a loaded and ambiguous word that I wince when I see it used by representatives of one group of regular American citizens (e.g., Ron Unz) or elected American officials (Biden) to describe another group of American citizens with whom they have strong philosophical differences.

    The word “militant” evokes images of “crazy anti vaxxers [sic!]” carrying LITERAL pitchforks and burning torches, ready with hot pitch and feathers intended for the LITERAL hide of anyone in a white coat working in a facility with a “Covid19 vaccines available” sign outside, or even anyone wearing a mask we think makes them look dumb.

    That’s just the way fomenters of chaos want ordinary citizens to view each other.

  231. Anonymous[170] • Disclaimer says:
    @Biff

    And their cause is crushing Russian fascism and make its fans eat 💩.

  232. Ron Unz says:
    @Balaji

    Have you considered going on Joe Rogan’s or The Dark Horse podcasts. Both of them believe that Covid is an engineered virus. However they think that there was a lab leak not that it was a bioweapon. I fear that even they may find you too controversial.

    Sure, I’d be very eager to discuss my theories on those podcasts or pretty much any others.

    I did several podcast interviews back in February, and they’ve been extremely successful, accumulating well over a million views on Rumble, generally getting 100x to 500x more viewership than the other videos on those same channels:

    https://www.unz.com/page/covid-biowarfare-articles/#podcast-interviews

    Based on that, I’d assumed it would be easy to get on lots of other podcasts, but I was entirely mistaken. With a couple of exceptions, I’ve had almost no luck anywhere, partly because so many of the alt-podcasters are have become zealous anti-vaxxers, focused overwhelmingly on that issue.

    I’m friendly with several other podcasters, and although they think my Covid analysis has considerable merit, they’ve told me flat-out they fear that having me as a guest might severely damage their careers or even get them deplatformed.

    Joe Rogan has a gigantic audience, and I just can’t imagine he’d risk having me as a guest, but Prof. Sachs would be ideal for him. How could anyone attack Rogan for interviewing the ultra-respectable chairman of the Covid Commission? If anyone has any links to Rogan, go ahead and suggest Sachs.

    As for the Dark Horse podcast, they’re much smaller and more in my league. I think they’ve been advocating the Wuhan lab-leak theory for a year or two, so I’d very much welcome the opportunity to explain my very different analysis of the facts and debate them on the merits. Please go ahead and suggest the idea that if you have any access to them.

  233. Franz says:
    @TKK

    They don’t want to believe they were duped.

    That’s the key. That’s the part that hurts.

    The wife wasn’t buying it till I printed out the full list of reactions from as many different sources as I could. The honestly think the propaganda they get from the TV and elsewhere is “THEIR” opinion.

  234. Franz says:
    @Weston Waroda

    I think Ron will come around.

    I sure hope so. The word of the reactions is reaching riot levels. I’d like to see all the good guys on the same page when the storm hits.

    • Agree: JimDandy, Mark Hunter
  235. @Thomm

    I don’t think you have figured out the true purpose of this website.

    If it is any help, I have not figured out the true purpose of this website, either. However, it is possible to appreciate things without understanding how or why they work.

    (My own guess is that Ron Unz runs the site largely because he delights in serving as the ringmaster of what is, even by the most generous interpretation, an intellectual circus of sorts.)

    Regardless of why it is here, I am grateful that it is here. And while I may not agree with everything I see on it, the site furnishes an example of how important it is to allow everyone to have their say and let the chips fall where they may.

    It is becoming more apparent with each passing day that the pro-censorship, “what we don’t know can’t hurt us” philosophy that seems to govern most of the Internet in 2022 makes for tedious (and as recent history has shown, potentially hazardous) reading. While unz.com may be accused of being a lot of things, I do not think boring is one of them.

    Let us hope Ron Unz has as much fun running the site as his readers do reading and debating on it.

  236. Mark Hunter says: • Website
    @Ron Unz

    … Danielle Anderson, who was working at the Wuhan lab at the time …

    And that is all you need to know about the integrity of Danielle Anderson.  Her work at the Wuhan lab benefited the Chinese military through the CCP’s policy of Military-Civil Fusion, and she must have known this.  Why believe anything she says?

  237. @Thomm

    Damn, you are one unhinged mother fucking anon.

    • Replies: @Thomm
    , @Ron Unz
  238. @TKK

    my mother used to be sharp as a tack and she is slipping everyday. It increased exponentially after the vax.

    I had a theory about that back in the second half of 2020 that has since proven substantially accurate.

    The theory was that the Covid vaxxes can cause a persons weakest physical link to manifest. A neighbor of mine who, for years, experienced occasional one day bouts of vertigo descended into a 2.5 month spell of nonstop vertigo. She was a mess! Many days she couldn’t drive and some days she couldn’t get out of bed the dizziness was so bad.

    Once she was finally better I asked when it started, then asked if she had taken the vaxxes and when? Her second jab was the third week of March 2020 and the unrelenting vertigo started about a week later. Yeah. Get this, two weeks after finally getting past that, in early June, she descends into what clearly seemed to be a hard case of Covid. I think she thought I was nuts when I said that but, now we know for certain that the vaxxed DO get Covid and, often, bad cases.

    I had read about others getting cancer recurrences or another type of cancer than the one they had years back. The vax-induced heart inflammation has killed alot of people too.

    • Replies: @Patrick McNally
  239. g wiltek says:

    Ron Unz. Look at the data. People ARE dying in excess, look at EURO MOMO and actuarial numbers from life insurance companies. It is really simple, really. And denial is not just a river in Egypt. I don’t for a moment trust any government any longer, so yes, Covid could be manufactured, sure, I too think it most likely is!!
    But by far the most dangerous effect of this plandemic is the control people allow to fester. It is the power of fear and propaganda, loss of liberties and forced compliance, which lead direct to serfdom. And the unfathomable lack of resistance. People are getting denser and denser by the day, and to me that is the problem. Logic no longer works because people don’t get it. We are then left with burning witches at the stake. Superstition is the daughter of ignorance. There is only one way out of this. Each one of us must do our bit.
    Resist, refuse, revolt!

  240. @Ron Unz

    Here’s the funny thing. Mr. Unz claims to agree that that the vaccines, which have been so strenuously propagandized and mandated by the government for nearly all they think they can assert authority over, regardless of age, “likely killed at least some thousands of people”, perhaps even “tens of thousands”. Moreover, he has decided against taking for himself the first booster shot and now the new booster ones.

    Yet at the same time, he can write that:

    A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere, probably now encompassing some 15-30% of the American population and almost monopolizing online Covid discourse

    as if it is some irrational phenomenon that can only be explained by Cass Sunstein-style “cognitive infiltrators”, and which calls for verbal abuse at every opportunity.

    No wonder so many readers and commenters have trouble believing he is rational or even sincere about his positions.

    • Agree: Mehen, Wild Man
    • Replies: @The Real World
  241. Dear Mr. Unz, you surely understand that we love and respect you, despite (or maybe because of) your eccentricity.

    You’ve continued your drum-beating around the origin of the alleged Corona Chan bug – as if its American genesis is a revelation. That ship has already sailed – years ago – because we know that Americans were at the center of Corona Chan’s development (just as they were instrumental to the success of the 911 false flag).

    What the Russians have disclosed only serves to confirm what we already knew – the USA is an Evil Empire intent on taking over the planet.

    [MORE]

    So the world has moved on – as have the psycopaths intent on ruling the world. Not you, though…

    However, I think a far larger factor in this pattern of silence is that over the last year or more so much of the alternative media has become totally focused upon an entirely different aspect of the Covid issue, namely the vaccines developed to combat the disease.

    It’s logical (would you not agree?) that common folk would have more concern over

    1. compulsory experimental injections designed by Big Pharma racketeers and certified eugenicists which have killed and maimed millions around the world;

    than

    2. an alleged bug which the official tests cannot detect and which the compulsory experimental injections cannot prevent and which has a case fatality rate of around 0.14%.

    BTW, do we need to restate the obvious – we already know from whence Corona Chan came, and we don’t much care about that in the midst of a global battle to save our sovereignty and our lives and our children’s lives from a highly organised and exceedingly powerful cabal of supranational psycopaths.

    Also BTW, please refrain from the hypocrisy of citing mainstream media in order to refute those assertions. Your eccentricity doesn’t excuse that.

    Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly.

    Indeed, this is what intelligent people understand to be the case.

    As an extreme example of this regrettable tendency, a couple of months ago Dr. David Martin, a prominent and influential anti-vaxxer, warned that up to one-third of the American population would soon be dead from vaxxing, and demanded Nuremberg-style tribunals for those responsible for this looming disaster.

    We are already seeing a statistically unprecedented explosion in all-cause mortality rates across the Western world – correlated to those nations with the highest experimental injection rates. Dismiss this fact at your credibility’s peril.

    We are also seeing a huge slide in birth rates across the Western world – correlated to those nations with the highest experimental injection rates. Again, dismiss this fact at your credibility’s peril.

    Dr. David Martin knows what he is talking about.

    I dare you to engage Dr. Martin in a public discussion of this subject.

    To your credit, you were an early mover on the idea that Corona Chan was made in America.

    Unfortunately, you’ve distinguished yourself as a one-trick pony.

    The world has moved on, and the battle in this war for the world has shifted from Corona Chan to new campaigns designed to consolidate the control frameworks ushered in by the Corona Chan campaign.

    We could continue to stand around in a circle and study the fine detail of an alleged bug’s creation which served as a Trojan Horse for the next phase of that initial campaign.

    Or we could continue to be responsive to the ongoing developments in the real world around us and survive.

    • Replies: @geokat62
  242. In the immediate circle of people I know who got the shots, two got lung cancer after the shots (they’re still alive), one man got a rare type of bladder cancer (he’s still alive) two died of cancer and almost every other person I know who got the shots felt horrible after getting the shots and some still have weakness in their arms, in their legs, foggy thinking. None of the people I know who didn’t get the shots has gotten really sick except for one who had the flu last winter. I regularly hear about high performing young athletes, local, national and international, dropping dead of no apparent reason, and celebrities dropping dead and getting facial paralysis and strokes. I suspected the covid shots from the start as being something rotten in Denmark, by the way the government, media and big pharma were all pushing them in unison. There’s never been so much agreement between so diverse a group in society as those three, why did they all come together for that? I smelled a rat from the beginning.

  243. @Wizard of Oz

    With assertions like this…

    I hope to get round to weaning g you off the rubbish about Nuland, McCain and other clowns pulling off a coup in Kyiv.

    … it seems that aspersions directed at the Wizard in these forums have been rather too lenient.

    Despite his refusal to engage the detail of certain subjects, Mr. Unz is inevitably and emphatically on target with his tier 2 geopolitical analysis. Always has been.

    And now the Wizard is going to school Mr. Unz on a subject like “f*ck the EU” Nuland?

    Perhaps we should just accept the irretrievable incorrigibility of a character like the Wiz – and let the child have his fun.

    • Replies: @Wizard of Oz
  244. @tanabear

    If you are mandated to take an experimental vaccine or lose your livelihood, you better believe lots of people are going to view this with far more urgency than the hypothetical origins of COVID-19.

    Touché. I was going to make a similar argument but tanabear and jimbojones have said it, and eloquently. Although Ron Unz is one of my heroes I can’t let him pooh-pooh the devastating effects of the so-called vaccines — which may not have fully revealed themselves even yet — without protest.

  245. meamjojo says:

    New Zealand turns anti-Covid, anti-vax! Who knew???
    ========
    New Zealand Scraps Nearly All COVID-19 Restrictions, Including Mask and Vaccination Mandates
    September 12, 2022

    New Zealand will be retiring its COVID-19 traffic light system and significantly scaling down COVID restrictions from Sept. 13 so Kiwis could “move forward with certainty,” Prime Minister Jacinda Ardern announced.

    “It’s time to safely turn the page on our COVID-19 management and live without the extraordinary measures we have previously used,” Ardern said, calling it a “milestone.”

    With the abolishment of the traffic light COVID protection framework, mask mandates will be lifted in all areas except in health care and aged care settings.

    Household contacts will no longer need to isolate, while people testing positive for COVID-19 will continue to be required to isolate for seven days.

    All government vaccine mandates will end on Sept. 26, and all vaccination requirements for incoming travellers and aircrew will also be removed.
    ….
    https://www.theepochtimes.com/new-zealand-scraps-nearly-all-covid-19-restrictions-including-mask-and-vaccination-mandates_4724789.html

  246. @jimbojones

    He believes Covid is real and dangerous because he believes Covid is real and dangerous.

    He believes vaccines do what they’re supposed to do and harm nobody because he believes vaccines do what they’re supposed to do and harm nobody.

    Check.

  247. Alfred says:

    My own views on vaccines have always been quite mainstream, and I view the anti-vaxxing movement as a tremendously misguided distraction

    8x increase in Excess Deaths among Children in Europe since COVID Vaccine roll-out according to Official EU Data

    Well, you don’t have children of your own. That is your choice. You clearly have little empathy for them. Nothing to see there!



    Video Link

  248. Levtraro says:
    @Bert

    Two Japanese computational biologists demonstrated (link below) that the Omicron variant was almost certainly created in a laboratory. .

    I examined the manuscript by the Japanese computational biologists.

    First, it is not peer-reviewed, it is just deposited in a repository of un-published research.

    Second, their main aim is to calculate a probability and I found their calculations to be way too simplistic, so simplistic as to make me think the whole excercise was futile. They used an incorrect probability distribution (whose name they misspell in the Abstract) for the probability of each mutation.

    • Replies: @Bert
  249. The alternative media community is growing with more investigative journalists, statisticians, doctors, researchers, academics, lawyers, and historians, who are “speaking out” about the virus–and yes, more so about the dangers of the vaccines. The information is critically necessary! Many people are dying. But you must know that.

    My feeling is the reason why this issue is taking front center headlines on alternative media platforms, such as substack, with an increasing number of writers, is because there happens to be more people working in these above fields, with bomb shell findings that are being exposed more blatantly all the time, and which desperately need to be reported now. For example, the completely inappropriate testing of the new bivalent booster shots. The number of athletes dying on the playing field. The number of cancer patients, children with myocarditis, and so on. It is too obvious to ignore, why these injuries and deaths are happening now! It hits people’s lives like no other media story especially when their loved ones are victims.

    The fire of people who “know” the truth about this is impressive. Whereas the virus being a bioweapon, has too many unknowns, too much politics involved. Plus, just mentioning Russian generals, or Putin, has too many propaganda-endorsed beliefs attached to it.

    I listened to Jeffery Sach’s interview with Robert Kennedy Jr, from the Children Health Defense website. RKJ, and his team are doing remarkable work, so needed! His political position has allowed him to speak out, unlike others, who sell their good graces to the kickbacks and future careers. RKJ is real and cares.

    In summary, I think the anti-vax issue is truly huge and very important, and so is the truth about the gain of function funding of covid virus as a bioweapon.

    The time will come, when alternative media will evolve to encompass all issues for their readers. We all need to help that along and be patient along the way.

    I suggest that you Ron Utz, start a substack page. More people will find you there.

    With Respect, Admiration and Humility, Blessings to You and your family.

    Hillary Adrian Han

  250. @tanabear

    The USA is the obvious guilty party because bio-warfare is what its ruling groups are capable of, and have done in the past. It’s a ‘slam dunk’.

  251. @Ron Unz

    Dark Horse has never mentioned Baric and his work, the UNC lab at Chapel Hill, AMRIID, and the US record of bio-terrorism. Weinstein is also an anthropogenic climate denialist, of the less extreme type, although he sees the submarine methane clathrates as the ONE risk of serious climate carnage. In that, by ignoring the numerous other positive feedbacks eg dying tropical forests, albedo flip in the Arctic, warming seas and soils emitting carbon or melting permafrost etc, he paints himself, in my opinion, as simple-minded or disingenuous.

  252. @Wizard of Oz

    Typical Wizz. His BELOVED USA would NEVER do nothing bad, would they Wizz? Those Nips had Hiroshima and Nagasaki coming, didn’t they. And those Koreans and Indochinese sure deserved the carpet-bombing, napalm, chemical warfare and…oops…biological warfare in Korea. Not to forget those Iraqis-what was it? Two million killed, civilian infrastructure including water treatment plants bombed, tens of thousands cowardly massacred in the ‘Turkey Shoot’ on the Kuwait-Basra Highway etc, etc, etc.
    But like ALL members of the Austfailian ruling class (great or minuscule), and Rightist thugs everywhere, the Wizz loves NOTHING more than kissing Yankee arse. It’s his life’s work. You’ll recognise him in the street by his brown nose.

    • Replies: @Wizard of Oz
  253. Levtraro says:
    @Thomm

    You have set the lowest standard of low class in this website.

  254. @Ron Unz

    Why confine yourself to the US?

    I have been thinking of ABC Radio National’s talk programs based usually, these days, on someone having written a book which, with jis staff, the compere/interviewer can master. After all you have a great number of books on which Phillipn Adams (Late Night Live) or Tom Switzer (Between the Lines) could base a 20 or 30+ minute segment. Phillip is an old lefty (Comm until 1956), film maker and former ad man who has interviewed very distinguished people over 35 years. Tom Switzer was against the Iraq War, an enthusiast for Mearsheimer, and – as Ribert Dallek told me in 2013 his youthful lodger for several weeks.
    I know Adams better than Switzer whose politics are closer to mine but, apart from a certain absence of Israel from their programs, I see no reason why they could not be persuaded to take you seriously. I would back you on The Lobby, some version o your Holocaust doubts and the Ivy League discrimination in particular.

    I have only just discovered the intelligent Balaji’s comments. His tone is remarkably benign but I can’t help asking with great tact if you could positively rule out the letters GC coming appropriately to mind?????

  255. I fnd myself getting irritated by your constant dismissal of anti-vaxers (Althought I am otherwise a great admirer of yours). Given the enormous and blatant level of criminality that now exists within the pharmaceutical industry and the scientific establishment that is supposed to underpin it why on earth should anyone trust anything that it produces?

  256. @Nancy

    So, if you’re right, what is causing the ‘epidemics’ of livestock disease? Especially in China? (BTW, I want to believe you, but)

    No-one knows. No-one has the explanation for these things. We don’t know.

  257. cohen says:

    I watched Ron Unz’s video discussion with Kevin Barrett’s group. As usual a lot of learning that I am happy about.
    At the end Ron brought Jeffery Sachs Covid commission.

    It is not a “Covid Commission” as perceived or credited to begin with. An illusion for confusion like the Federal Reserve name sold as a Federal Agency (because the name “Federal”: In the good old days the Fed Reserve was listed next to Federal Express in the White Pages of Telephone directory and not in Blue pages.

    This a Lancet Magazine’s commission on Covid. Funded by a “Generous” Grant from the Rockefeller Foundation
    https://covid19commission.org/

    There are Covid commissions all over we can choose whichever suts our narrative. one example
    https://www.cms.gov/newsroom/press-releases/independent-nursing-home-covid-19-commission-findings-validate-unprecedented-federal-response

    It reminds me of one meeting on Environmental Policies that I attended in UN Paris office. One of the speaker proudly announcing of a new award called something……. UN environmental award. Believe me there were tons of UN awards on environmental achievements/studies…. mostly in Western hemisphere (easily available grants). I raised one simple question that why there were so many awards all over the place instead of consolidating into few. During the break I was surprised to be surrounded with severals attendees shaking my hand and complimenting about the question with a smile.
    Bottom line: you can have several commissions with fancy names to create illusion. Yes non credible and for simple illusion

    I had no clue about Jeffery Sachs till I read Ron’s few article. Mr. Sachs a professor in Economics is portrayed as a “Pillar” on matters on Covid and Sustainability. I have done environmental work for over 40 years and I would love to ask Jeffery some really simple questions about his knowledge on sustainability.

    If you go to Lancet Commission page

    https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)31494-X/fulltext

    you will find some the usual suspects and articles and references………. WHO

    Of course Covid is most likely bio weapon and before Covid we had all kinds of bio weapons developed by various countries. Remember Lyme disease. For USSR.. Mostly spread on the East coast near Long Island labs.

  258. A123 says: • Website
    @RoboMoralFascist 1st

    Let us ask…

    1) How does a 2016 Moderna patented sequence make its way into the COVID 19 strain?

    Patents are public knowledge. Commercial research would face some limitations. However, the CCP is well known for egregious IP theft. The involvement of Elite Leftist universities with WIV would provide cover (e.g. Moderna Corp academia grant) if the IP was detected.

    The highly plausible way for the sequence to wind up in the WUHAN-19 virus is straightforward. The CCP’s Wuhan Institute of Virology [WIV] inserted it.

    2) How do we know that the outbreak in Qom Iran was connected to China instead of a separate attack?

    The circumstantial evidence strongly suggests a natural spread from China to Iran.

    • The WUHAN-19 virus can move about on airplanes in those with few or no symptoms.
    • Both nations have closely interrelated business/government/military structures, such as State Owned Enterprises.
    • China is Iran’s foremost diplomatic/commercial link.
    • The CCP remembers the issue their communist ally the USSR had with gerontocracy. They systematically push for a middle aged and healthier hierarchy. On the other hand, Iran has leaders selected for fervent loyalty to the revolution. This makes Iranian leaders, on average, older at each level.

    It is highly plausible that a CCP diplomatic/commercial mission came into contact with WUHAN-19 vulnerable Iranians. It does not even need to be the diplomats themselves. The carrier “super spreader” could be among the even younger and healthier security entourage.

    The idea that the U.S. could deliberately launch a viral attack targeting specific individuals is implausible, bordering on absurd. Gaining access without getting caught requires significant range, for example a remotely controlled machine gun. The termination of Solemani was performed with full standoff weapons.

    PEACE 😇

  259. A123 says: • Website
    @niceland

    That’s interesting, thanks!

    Listening to Sachs describing his experience in the covid commission is incredible. Members of the commission lying to him, trying to hide or distort facts and the overall lack of will to dig deep (and discover the truth!?). This just can’t be ignored unless one believes Mr. Sachs has zero credibility.

    It is even more interesting with additional context. Let is go directly to a paper co-authored by Jeffery Sachs (1)

    A call for an independent inquiry into the origin of the SARS-CoV-2 virus

    A broad spectrum of coronavirus research work was done not only in Wuhan (including groups at Wuhan University and the Wuhan CDC, as well as WIV) but also in the United States. The exact details of the fieldwork and laboratory work of the EHA-WIV-UNC partnership, and the engagement of other institutions in the United States and China, has not been disclosed for independent analysis. The precise nature of the experiments that were conducted, including the full array of viruses collected from the field and the subsequent sequencing and manipulation of those viruses, remains unknown.

    The NIH could say more about the possible role of its grantees in the emergence of SARS-CoV-2, yet the agency has failed to reveal to the public the possibility that SARS-CoV-2 emerged from a research-associated event, even though several researchers raised that concern on February 1, 2020, in a phone conversation that was documented by email (5). Those emails were released to the public only through FOIA, and they suggest that the NIH leadership took an early and active role in promoting the “zoonotic hypothesis” and the rejection of the laboratory-associated hypothesis (5). The NIH has resisted the release of important evidence, such as the grant proposals and project reports of EHA, and has continued to redact materials released under FOIA, including a remarkable 290-page redaction in a recent FOIA release.

    Most telling is this commentary “SARS-CoV-2 emerged from a research-associated event”. Jeffery Sachs is clearly pointing his finger at WIV as Origin.

    It is equally clear that Sachs believes the U.S., specifically NIH, is covering up relationships with WIV, and possibly other bio labs in Wuhan. There is much for American Leftoids to be worried about — The use of a U.S. patented gene sequence, funding via the EcoHealth Alliance, connection to Elite institutions important to DNC politicians, etc.

    PEACE 😇
    __________

    (1) https://www.pnas.org/doi/10.1073/pnas.2202769119

    • Agree: Wizard of Oz
  260. CBB says:
    @chris

    “Almost to underscore Ron‘s point in this excellent article, I had gone to listen to Alex Jones after he was slapped with the ridiculous Sandy Hook lawsuit, and in his show, he referred directly to Jeffrey Sachs‘ shocking conclusion that Covid came out of a bio lab, WITHOUT telling his listeners that Sachs had said this was a “US“ bio lab!!”

    Total BS. Within weeks of the pandemic’s start, Jones had on his show, multiple times, Dr. Francis Boyle, who drafted the US domestic implementing legislation for the Biological Weapons Convention, known as the Biological Weapons Anti-Terrorism Act of 1989. Boyle from the start called the pandemic bioterrorism, and from the start pinned the blame on the U.S., specifically Tony Fauci and Ralph Baric of the University of North Carolina, whose work on modifying coronaviruses to make them more contagious goes back to the early 2000s. Boyle knew about the Fauci/Baric patents, and the whole sorry progression of those patents from the late 1990s to today was later documented fully by the very same David Martin that Ron Unz keeps insisting is a crazy antivaxxer who doesn’t care about the origins of Covid. Talk about pissing on an ally.

    Jones has also interviewed on his show Steve Kirsch, Dr. McCullough, Dr. Malone, RFK Jr, and many other experts on the subject. He’s even had McCullough guest host. And by the way, contra Unz, Kirsch, McCullough, and Malone are so anti-vax that they each took took the initial jabs as soon as they became available. Malone, an inventor of mRNA vaccine technology in the early 1990s, became skeptical after experiencing a serious adverse event himself. Kirsch changed his mind after hearing from friends and acquaintances who were damaged.

    As someone else pointed out, Unz doesn’t help his case by referring to Sachs as the “head of our Covid Commission,” first because “our commissions,” like Warren and 9/11, have been cover-up operations, and second because it was a Lancet commission, not “ours”. Unfortunately, the Lancet had already destroyed its reputation over Covid, first publishing a letter written by the very people involved in the lab work saying the virus had to be of natural origin, then later publishing a paper on the “dangers” of hydroxychloroquine that had to be retracted just two weeks later because its “extensive” data was made up out of thin air. Worse, it wasn’t the Lancet that uncovered the fraud but two co-authors of the paper, who’d never been allowed to see the “data” created by the third author. Worse still, the fraudulent paper was used to stop other trials on hydroxychloroquine and is still cited by idiots and liars to this day.

    • Agree: Mehen, allergic2katz
    • Replies: @geokat62
    , @chris
  261. Emslander says:

    The must-read article of the day is Dr. Naomi Wolf on Lew Rockwell and on her own web site.

    I won’t spoil it.

    • Agree: Jefferson Temple
  262. Johan says:
    @Thomm

    I’d say that the host in the video looks like an average joe blockhead. Nobody can help looking like that, and many women, as women -and especially American women- are known to have a bad taste, will like his looks, and who knows what a pleasant personality he might have, but putting the camera at a low angle to rub the average joe sturdy facial hair in someone’s face is unforgivable.
    Compare Mister Unz, nicely clean and shaven, and a promising shape of skull which gives away that he is an advanced thinking man, evolutionary ahead of democratic apeman.
    It appears Thomm really has a democratic-popular taste, which solely by account of its nature adds insult to injury on a daily basis, popularly never being made aware of it.

  263. geokat62 says:
    @Ultrafart the Brave

    and which has a case fatality rate of around 0.14%.

    It has a infection fatality rate of around 0.14%. The CFR is quite higher.

    • Thanks: Ultrafart the Brave
  264. @Ultrafart the Brave

    You expose your trivialising self by implicitly putting that infamous Nuland quote up front as your reason for believing the Russian propaganda version of the ousting of the President (which resulted from a vote against him in the legislature after which he fled). What fo you know about Ukraine. I caught Cobid at dinner a couple of months ago from a 40 year old businessman who was telling about the so-called Maidan revolution from the vantage point of one who was living and working in central Kyiv at the time. Your superior source(s)?

    • Replies: @Ultrafart the Brave
  265. @mulga mumblebrain

    Even the stupidest drugged up threadster on UR will see how plain silly you are being when you respond with that gush of nonsense to my pointing out that Americans had reason to stage a cover up apart from any possible biowarfare.

  266. geokat62 says:
    @CBB

    And by the way, contra Unz, Kirsch, McCullough, and Malone are so anti-vax that they each took took the initial jabs as soon as they became available.

    If I’m not mistaken, Dr McCullough has publicly stated he has not taken the jab.

    • Replies: @CBB
  267. @Zachary Smith

    The “Anti-vaxx” label is unfair, then again, so is life.

    Anti All Vaxx ? No, anti mRna vaccines – a very risky experiment.

    Vector vaccines are a less risky experiment. Sputnik and Johnson & Johnson – Sputnik is based on human adenoid virus and J&J simian adenoid virus

    Weakened live vaccines are proven but can revert to virulent – e.g. polio oral vaccine

    Killed vaccines – proven and least risky. Sinovac and Sinopharm

    Why was the west pushing mRna vaccines and suppressing Sputnik and Sinovac, Sinopharm ?

    At the beginning of the “crisis” a Russian scientist said (paraphrasing) “not to boast, I can make a vaccine in a few hours, but will it be safe, effective, for this YEARS of testing is needed”

    Also, well know epidemiologists, at the beginning of the “crisis” said vaccines were inappropriate at the early stage of the virus spread. The virus would mutate and stabilize. Then vaccines would be appropriate.
    Finally, well known doctors said treatment was important to mitigate the suffering and speed up the healing of the infected. Instead, effective treatments were suppressed and ineffective treatments were promoted.

    People are “anti-vaxx” for a reason. mRna is a massive experiment – risk free because of waiver of liability – and no-cost since the state is paying for it all. How many billions of dollars and years would it take to normally do this amount of testing ?

    It is “main stream” to be vaccinated. Popular opinion is not “science”. In fact, to me, the rush to get vaccinated, looked “status eager” – i.e. to have cutting edge technology – the latest and greatest.

    And now, no one would dare admit that they were “cheated”. On Pat Lang’s blog, IIRC the commentator “Walrus” said – paraphrasing: “getting vaccinated would be an intelligence test and in a few months we would see who passed it” well, what is the result – wave upon wave of mutations “likely” caused by the survival bias of Covid virus in the vaccinated.

  268. A123 says: • Website
    @Ron Unz

    The best Western eye-witness was veteran Australian virologist Danielle Anderson, who was working at the Wuhan lab at the time. She said the safety precautions were outstanding, no one became ill, there wasn’t any sign of a leak, and she very much doubts that Covid was developed there.

    Except we know from the later EcoHealth Alliance disclosures, WIV was doing exactly the type of work needed to develop FCS enhanced coronavirus at WIV.

    Given that Ms. Anderson was 100% wrong about the type of research being performed at WIV, all smart, honest observers grasp that her assertions about the quality of WIV lab procedures are equally dubious.

    We do not know how good or bad “leak” safety was at WIV.
    ___

    Also, there are many “non-leak” scenarios.

    For example — Theft & sale of apparently healthy, but contaminated, lab animals slated for destruction is consistent with WIV as Origin and “Patient Zero” at the Wet Market ~8 miles away.

    PEACE 😇

  269. Ron Unz: “Pompeo’s people just gave the MSM an unsubstantiated, third-party intelligence claim that three Wuhan lab researchers had fallen ill with Covid-like symptoms. The big story reporting that was in the WSJ by one of the same reporters who’d co-authored all the Saddam WMD stories a couple of decades earlier. … [They are] Pompeo’s henchmen.”

    Are you claiming that there was no report at all, just a report of a report planted by people who were Pompeo’s “henchmen”? But what about the State Department fact sheet, which predates the WSJ article by several months? Just more of Pompeo’s lies?

    https://ge.usembassy.gov/fact-sheet-activity-at-the-wuhan-institute-of-virology/

    Elsewhere, you’ve argued vociferously that a November NCMI report of a Wuhan outbreak existed. What if this was the same report? One that said that there had been a potentially “cataclysmic” leak at the WIV? I don’t see how you can rule it out. But given that copies of this report are unavailable (some commenters have even been arguing with you that it doesn’t exist), that’s going to be pretty hard to ascertain either way. Nevertheless, this supposition puts you in a quandary. Your theory needs the report to exist, as it’s your “smoking gun”. But if it does exist, and it included the information about a lab leak at WIV, your theory collapses!

    Ron Unz: “The best Western eye-witness was veteran Australian virologist Danielle Anderson, who was working at the Wuhan lab at the time.”

    Unlike Jeffrey Sachs, Danielle Anderson says she favors the natural occurrence theory. But in the article you linked, you also wrote:

    Fearful of the possible international consequences of such explosive charges [i.e., of Covid being a Chinese bio-weapon], well-intentioned scientists mobilized behind the defense that the virus was entirely natural, whether or not they actually believed the evidence was as strong as they claimed.

    How do we know this doesn’t explain her remarks, too? Seems to me you’ve got some serious double standards going on.

  270. @Ron Unz

    This may give more context to the problems you highlight

    https://quadrant.org.au/opinion/doomed-planet/2022/08/shut-them-up-argues-the-academy-of-science/

    It was a link in a letter to me from an old friend with a science degree and background in mining and farming
    Which attached a proposed advertorial that I am sorry I have been unable to copy and paste as they should be printed

    [MORE]

    CLIMATE REALISMWrong, as plants absorb carbon dioxide (CO2) an essential nutrient, then decay into fossil fuels. USE OF FOSSIL FUEL RETURNS CO2 FOR PLANTS TO ABSORB AGAIN FOR ABUNDANT GROWTH. Plants are part of the food chain and life on Earth depends on the availability of CO2 for plant growth.Correct, because a study published in the journal ‘Nature’ concludes because of fossil fuel emissions plants are able to utilise 30% more CO2, spurring plant growth. For Australia, there is an excess of CO2 absorbed from the atmosphere compared with emissions. It has been estimated 2.3 tonnes of CO2 are captured by plants for every tonne emitted.Wrong, as geological markers show over 400 million years ago life flourished when CO2 was 7,000 parts per million (ppm) and has now declined to a near record low of 411ppm. There is no observed scientic evidence from geology that CO2 has ever caused a “global climate catastrophe”.Wrong, because the Australian Institute of Marine Science has reported that most coral coverage is at its highest level since monitoring began 36 years ago.Wrong, as subsidies for intermittent renewables and their priority access to market displaces coal generation. As a result, Australian power costs continue to increase from the lowest to near the highest in the world for households and industry.Wrong, because such predictions have failed. For example, a forecast in 2007 made by a leading Australian climate change advocate predicted that global warming “was so baking that even the rain that falls isn’t actually going to fill our dams and our river systems”. Dams for Brisbane, Canberra and Sydney have since lled to near overowing.It turns out what has been relevant for Australian climate was made in 1908 by Dorothea Mackellar in her poem ‘My Country’ that Australia was a land “of droughts and flooding rains”. Meanwhile, nothing has changed and there has been insufcient attention to address ood mitigation, preparation for droughts and building dams.The Climate Study Group“Carbon dioxide is a pollutant.”“The return of CO2 is encouraging plant growth.” “Fossil fuel emissions can cause a global climate catastrophe.”“The Great Barrier Reef is being destroyed by climate change.” “Intermittent renewables will reduce power costs.”“Models and science predict a global climate catastrophe caused by CO2 emissions.” CONCLUSION: THE FACTS DO NOT SUPPORT PREDICTIONS OF GLOBAL CLIMATE CATASTROPHE CAUSED BY CO2 EMISSIONS. A number of countries have reached the same conclusion by building and planning 345 coal red stations with an operating life of at least 50 years.

    and

    a picture of a an electric vehicle charging station powered by a fiesel engine – which may simply irritate the serious minded.

  271. @Weston Waroda

    Consider also that by the time the Russian military came out with this revalation, the alternative media was immersed in other stories and rather sick of talking about ‘COVID’.
    This was spring of 2022, I remember the Russian announcment was featured on Zero Hedge and was discussed in brief on some podcasts but everyone was cranked up about the treatment of the ‘January 6’ demo participants. there was a School shooting- no shortage of diversions.

    • Replies: @terraintheory
  272. CBB says:
    @geokat62

    You could be right. Kirsch and Malone both discussed having been vaxxed in the Brett Weinstein podcast that brought all of them to widespread attention. I’ve seen so many videos with McCullough since then that it would be hard to find a definite answer, but I do find just now that McCullough had Covid in November 2020, just before the shots were introduced, so might have used that as a reason not to get the vax his hospital (that later fired him for being right) was surely pushing.

  273. Jeffrey Sachs is a fool who has wasted his life . This geriatric milque-toast conformist allies himself with sustainable development , climate change , and germ theory crisis capitalism industries simply by virtue of the fact that he is a philosophical rationalist-materialist , just like the spiritual idiot Ron Unz…

    Unz has lost a lot of credibility with me throughout this whole Pharmakeia charade …

    Grow up – chaos and your theories of chance and accident and “good intentions” or whatever this colossal misunderstanding of human nature is leads you to obscene “logical” mental masturbations based on fundamentally flawed idea about human nature… 500,000 letters of anal-gazing autistic “fact-seeking”… puke .

    stupid.

  274. This is way old by now ….

    When you gonna apply your autism to TERRIAN vs. GERM THEORY ?

    Have you really failed to address this aspect of the entire situation ?

    I wonder why you have never really addressed this @ronunz …

    Do you just consider it ridiculous or what ?

    • Replies: @MarkU
  275. Thomm says:
    @Astuteobservor II

    Hardly. I called Ron Unz’s bluff with epic elan. I told him that if I am anything other than one of the most valuable commenters here, I insist he ban me at delete all my past comments. Like I never existed.

    He declined to do that within the window of time that was offered. Hence, he effectively admitted that I am one of the most valuable commenters here. Remember that the true purpose of this website is very different than what is advertised.

    • Replies: @bombthe3gorgesdam
  276. @Generalfeldmarschall von Hindenburg

    Russian military “Revelations” (straight from God no doubt) propagated via totally above ground media conglomerate …

    😉

  277. Ron Unz says:
    @Astuteobservor II

    Damn, you are one unhinged mother fucking anon.

    I’m not sure I’d agree with “Thomm” that he’s one of the most valuable commenters here, but he’s certainly one of the most amusing. He’s left around 3,000 comments here, and it’s best to start reading them from the beginning:

    https://www.unz.com/comments/all/?commenterfilter=thomm&CommentOrder=ASC

    He starts off crudely boasting to everyone that Indian immigrants are the smartest, most successful people in America. So naturally enough, some of the other commenters say he’s probably an Indian immigrant. But given his tremendous personal dishonesty, he fiercely denies it, and begins pretending he’s a native-born white American. However, he obviously knows almost nothing about American society or history, so he says the most ridiculous things, presumably nonsense he picked up from Bollywood movies or random websites. For example:

    As I often point out, it was true until very recently that Italians, Poles, Jews, and even Irish were not considered white (and WNs still don’t consider them white, based on comments in this very thread). See my comment #108.

    I think he claims that Americans didn’t consider Polish or Irish people “white” until around 1950 or so.

    If I tried to pretend that I was a Hindu from India, I’m sure I’d make just as big a fool of myself, which is why I wouldn’t do such a thing. Some Indian immigrants are smart, but definitely not “Thomm”…

    • LOL: chris
    • Replies: @loveshumanity
  278. geokat62 says:

    The Dutch government is getting desperate trying not to disclose the underlying reason for excess deaths.

    Telegram comment posted by Dr Roger Hodkinson:

    “Hundreds of excess deaths per week and nobody knows why.”

    Everybody knows why, but the Dutch government is withholding vaccinations records because of – you guessed it – ‘privacy reasons’.

    Join 👉 https://t.me/RogerHodkinson

    https://t.me/RogerHodkinson/538

    • Replies: @Rumpelstiltskin
  279. @Wizard of Oz

    I have maintained from the begining of the Covid-19 plandemic that it was preparation for world war. If Ron’s theory is correct then the biowarfare attack on PR China and Iran was actually the first military operation and Russia’s SMO in the Ukraine is the asymmetric response. You have to look at the big picture, and this is how future history books should record the unfolding of events in this war.

  280. Anonymous[112] • Disclaimer says:

    Ron,

    Please understand that my government (and/or employer) coercing me into taking a vaccine that I think is a) unnecessary and b) potentially dangerous to my health will always be a more important issue than the origins of the disease. Always.

    One affects my daily life directly. The other does not.

    About 30% of the population feels similarly. No conspiracy to distract from your theory is necessary.

  281. geokat62 says:

    Telegram comment posted by EdwardDowd:

    What if I told you that in general that group life populations fair better than the total US population from a mortality standpoint. What if I then told you that this was the case in the last nine months of 2020 but group life in 2021 was proportionally worse than the overall US population. What if I also told you that the Society of Actuaries are reporting this today in a new report.

    We got ‘em folks. What changed in 2021? Gee I wonder!

    @DowdEdward

    https://t.me/DowdEdward/1087

    • Thanks: Mehen
  282. geokat62 says:

    Excerpt from Turbo-Cancer
    We have a problem
    :

    Dr. Kruger stated that she sees vaccination as a trigger for fast-growing tumors and autoimmune diseases. She’s seeing a lot of inflammation alongside tumors, and of course, it’s not only breast cancer. Many other pathologists have reported to Dr. Kruger that they’re seeing an elevation in cancers, cancers in multiple organs, and rare cancers.
    She ended off by saying “I studied medicine because I wanted to help people. But now it feels like I’m watching people being killed and there’s nothing I can do”.

    https://etana.substack.com/p/turbo-cancer

  283. Anon[367] • Disclaimer says:

    [Most fervent anti-vaxxers have only slight interest in the origins of the virus itself, which they dismiss as unimportant, and many of them doubt that Covid is dangerous or even that it exists, while they believe that the vaccines are enormously deadly.]

    [My own views on vaccines have always been quite mainstream, and I view the anti-vaxxing movement as a tremendously misguided distraction, so much so that I have speculated it might have been deliberately fostered for exactly that reason.]

    I agree with an awful lot of what you write, but this is one point where I disagree with you. I’ve been reading and watching a lot of alternative media since March of 2020 (haven’t we all?), and I suspect you’re only seeing part of the picture. For instance, Joseph Mercola, Pam Popper, Richard Fleming, etc. all are on record not only opposing the shots but also publishing that covid is man-made (and likely from a biolab). While I respect that David Martin is pursuing legal action against Fauci, et al, I don’t listen or read much from a lot in the anti-vax movement simply because of some of the things you point out (e.g. – that covid – or any virus generally – doesn’t exist).

    I disagree that emphasizing the shots is unimportant (which appears to be your position). When Resident Brandon (er, president Biden) gets up in front of the country and states that “our patience is wearing thin” to those of us who have refused the shots, when people are ousted from their jobs, careers, education, etc. for refusing the shots, and when people start collapsing and dying after having had the shots (particularly the young and athletic), the shots are damn important. At least as important as the artificial origin of covid. And after reading the documents from Event 201 (yes, that really did happen and it’s published on the Johns Hopkins University website), it’s plain to see that getting a needle in every arm was a high priority for the powers-that-be. So the focus on the shots, in my view, is at least as important as the origin of the virus.

    By the way, I completely agree with you that the US government is the real bio-terrorist. And I’m not the only one. There is an American expat living in China who produced several videos that were on YouTube (I haven’t checked lately to see if they’re still there), who also believes that it was the US government who created and deployed covid. In fact, his video from early 2020 (January?) says as much, so I believe he beat everybody to the punch. [Now I wish I had downloaded the videos, though I will look for them again.]

    • Replies: @Ron Unz
  284. @nsa

    Hahaha. I’ve relocated to the Vaikuntha lokas and am no longer entitled to an agreed button to smash!

  285. Ron Unz says:
    @Anon

    For instance, Joseph Mercola, Pam Popper, Richard Fleming, etc. all are on record not only opposing the shots but also publishing that covid is man-made (and likely from a biolab).

    Sure, there’s been a strong current of support for Covid being artificial from January 2020 onward. The Wuhan lab-leak theory was heavily promoted on the Internet by all sorts of anti-China groups and pundits, including American propaganda-organs. Pompeo and many other senior Trump officials made this exact public claim. Given that’s there’s very strong scientific evidence that Covid was bioengineered, that’s hardly surprising.

    But for more than two years, I think I’ve been virtually alone in pointing to the strong evidence that it was an American bioweapon, deliberately released in an attack against China (and Iran). I think you’d have a very hard time finding too many other people who’ve been saying that.

    There is an American expat living in China who produced several videos that were on YouTube (I haven’t checked lately to see if they’re still there), who also believes that it was the US government who created and deployed covid.

    Sure, I think you’re probably talking about the fellow who calls himself “Metallicman.” Although he has a range of very eccentric beliefs, he provided some of the earliest information I drew upon, and I republished his long post. That’s why I say “virtually” no one else. I similarly republished and the opinions of a purported 40 year veteran of American biodefense who had the same view:

    https://www.unz.com/article/was-the-2020-wuhan-coronavirus-an-engineered-biological-attack-on-china-by-america-for-geopolitical-advantage/

    https://www.unz.com/article/was-coronavirus-a-biowarfare-attack-against-china/

    If you look at my original April 2020 article, you’ll see that I cited and quoted both of those individuals:

    https://www.unz.com/runz/american-pravda-our-coronavirus-catastrophe-as-biowarfare-blowback/

    On the other hand, I personally think the “Event 201” story is just nonsense and probably had nothing to do with the Covid outbreak although the excitable conspiracy-activists were all talking about it at the time.

  286. Rurik says:
    @Ron Unz

    “Thomm.” He’s just a notorious Hindu immigrant troll who hangs around here.

    The reason he’s so ticked off at me is that he was pretending to be a white American,

    I seem to recall a brush with him long ago.

    The thing that I remember most, was the distinct impression I got of him being the quintessential incel.

    And then on top of that, having a bursting butt-hurt over being a non-white.

    Most people of color, (if that’s what they prefer to be called) are comfortable in their skin, (and why not).

    But what I think happens (in particular) to Hindus, is they become obsessed with the darkness of their skin. This obsession actually pervades every segment of their society. It all goes to the caste system, and how the darker the skin, the lower the caste. So they go around buying products to lighten their skin, and avoiding sunlight at all costs. It’s kind of sad, really, but there it is.

    And so then this Thomm incel posts his butt-hurt drivel, and it screams beware: angry incel warning!

    I think there should be places such guys can go to, for relief (maybe with those dolls or something). This profile, the butt-hurt incel, is what we see so often with those shooters.

  287. Rurik says:
    @nsa

    Shockski and Aweski were required on the first day of hosilities to avoid a proxy war with the USSA and its 29 nato butt bitches i.e. take out the entire west ukie power grid and let the globohomoschlomo simps live in the dark, starve, and eventually eat each other. Maybe self-preservation would kick in and 10 million ukies would exodus overruning several of the eastern euroweanie satraps.

    The alternative for the blundering Rooskies is a nato nazi globohomoschlomo proxy forever war on their border draining manpower and resources for many decades to come…….

    winter is coming

    cleaning out the Ukraine would still leave the Euroweanies grazing all over Europe.

    what’s needed is a persuasive argument (freezing and starving) to motivate the bovine Euroweanies to disentangle themselves from (((NATO))) / Globohomoscholmo, so they can roust themselves from their collective catatonic demon possession, let their sons be boys, and their daughters be girls again, and join with Russia as a bulwark against the plague that has occupied the continent ever since they “won” the war.

    What’s needed is a harsh medicine, because the poison runs very, very deep. Cleaning out Ukraine, will only leave the rot to fester to the west.

    Better for the medicine to be gulped by all of Europe, if that’s what it takes. And few things concentrate the mind, like starving and freezing.

    >><<

    note to moderator, my last two posts are off topic, feel free to delete both if you feel they're a distraction to this important article. .

    • Replies: @Abdul Alhazred
  288. @Si1ver1ock

    One of the greatest memes of the whole pandemic!

    A defensive posture must include an offense, because this is an offense against us as it is premeditated murder, and Ron Unz knows about the Pfizer Docs but continues to post swill.

  289. d dan says:
    @Vidi

    “Possibly a major reason for the silence of the alternative media is that many of these sites committed themselves to blaming China for originating Covid-19”

    That was my first reaction too. But upon further thinking, why can’t the alternative media still report Sachs’ latest announcement? Sachs doesn’t explicitly rule out the “Wuhan-leak” possibility, and it is possible for those “Wuhan-leak” clowns to twist Sachs words and claim that Sachs “concludes” it was a “Wuhan-leak”, like several trolls are doing here in Unz? They could even brag that Sachs simply “confirms” what they had known 2 years ago.

    Certainly we can’t rule out the CIA/deep state influence or monetary incentive for the media, alternative or not. My other theory is because most people, especially Westerners only care what is in front of their nose. Alternative media is no different to the MSM in wanting to chase the latest fads to cater for their audience. The death of one celebrity (e.g. the queen) is much more news-worthy and eye-catching than the deaths of million nameless Covid-19 victims. As to the pre-historic archaic question like the origin of black holes, eh… Covid-19, that is reserved for ivory tower archeologist like professor Unz. This also fits my belief that media does not always lead public opinion, but often follow popular trend. For example, a society is racist/anti-China/anti-Russia not because the Jews-this-Jews-that media tell the people so, but rather because there was already wide-spread or hidden undercurrents of those feeling and/or instinct among the lemmings.

    • Replies: @Marcion
    , @Rurik
    , @Wizard of Oz
  290. @Rurik

    A perfectly appropriate quote to which I am glad that is up, because it speaks exactly to the point, that indeed there needs to be an overthrow of the financial oligarchy in Europe…

    Occupy City of London, tear down the dragon statues guarding the money changers turning the planet into a black rock!

    • Agree: Rurik
  291. Marcion says:
    @d dan

    I think your comment is the one that deserves the coveted golden frame.

    • LOL: Wizard of Oz
  292. I do agree with Unz that it is worth emphasizing that SARS-COV2 is engineered, not natural, and that it was at least substantially cooked up by US citizens with US funding.

    But that’s about it. Is there anything new in this article? If so I missed it. Yet he’s churning out these poorly-received columns like clockwork, for some reason.

    I see a number of people continuing to express positive and hopeful takes that ‘he will eventually come aroung to reason.’ I’m dubious. It’s one thing to make mistakes; we all do. It’s another thing to argue in bad faith, as he clearly has.

    He won’t acknowledge even the most obvious problems with his talking points, like the fraudulent use of the PCR tests and the suppression of effective Covid treatments, both of which call into serious question the 18 million figure; or the fact that the mRNA programs peoples’ cells to produce the toxic part of what he calls a bioweapon.

    Solid arguments against his views he either disregards or dodges by disclaiming any interest in vaccines, then quickly reverts to insulting those who argue against his stance.

    And then there is his rock-hard obtuseness regarding why people consider the injections to be a more pressing concern than speculating about the origin of the virus and its leak/release. It’s been well-explained to him by many commenters, but it’s never resulted in any useful dialogue, much less reappraisal. He disregards it all and repeats his talking points, with no concern for how bad it makes him look.

    And then there are all his trolling comments (I did get a laugh from his first salvo on this thread).

    A couple of columns ago he complained that those of us who have become critical of him ‘regard me as an enemy because I’m not an anti-vaxxer’. Really, Ron? And do you think we consider all of our loved ones who aren’t ‘anti-vaxxers’ to be enemies? This kind of absurd mis-construal of criticism is telling, and ought to prompt some serious reflection on your part, if indeed you’re doing it unconsciously. FYI: disrespect backed by disingenuity provokes hostility.

    But my favorite one from that column was his “anti-vaxxing is fun”. Never mind all the lost jobs and careers, strained or broken relationships, ‘anti-vaxxery’ prompted by injury or death, etc. Whereas his stance is dangerous and courageous. I would grant that about danger and courage were it not for the fact that Unz is covering for far more criminality than he is calling out:

    under my scenario, there were only a tiny handful of rogue conspirators

    • Agree: Mehen, Random Anonymous
  293. Ron Unz for all the goods he has done, exposing muttmerica, the holohoax, etc.

    Is trapped in the “institutions” just like every boomer.

    But his subconcious reasoning is at least to me sympathetic. We are talking about a huge majority of world’s medical authorities joining in on this hoax, this evil experiment, the the supposed men of science being pussies, cowards who refused to stand up for the truth.

    If God wills it, the truth comes out. And the masses will have lost the last bit of refuge they can have. Medical institutions. They will not be able to trust the doctors for anything. This is way worse than boycotting the cops/pigs, whom some people could go their entire lives without any significant interaction. We are talking about people who are supposed to safeguard health.

    It will be the final straw, and can actually cause a mad max type breakdown, worldwide, since almost every single country, save for a few Catholic ones, have joined in the Hoax. Even Russia. Espcially China.

    Of course, in Russia and China they were doing traditional flu shots or placebo, because they are not retarded. And the lockdowns are all conveniently all organized in industrial and logistic export hubs.

    But that is beside the point. We are talking about the breakdown of the only vestige of trust for the masses. And it will be ugly.

    Pray to God. Don’t take the jab. Buy fake vax passes if you have to.

    Things are going to get rough.

    • Replies: @Rumpelstiltskin
    , @Ron Unz
  294. Rurik says:
    @d dan

    For example, a society is racist/anti-China/anti-Russia not because the Jews-this-Jews-that media tell the people so, but rather because there was already wide-spread or hidden undercurrents of those feeling and/or instinct among the lemmings.

    exactly!

    the American people have always hated Iraq, it was only a matter of time before they insisted on Shock and Awe, Dubya and the media simply couldn’t keep a lid on the anti-Iraqi sentiments that has always simmered in America.

    Ditto the destruction of Libya and Syria and the on-going destruction of Yemen. When the American people hate Syrians the way they always have, red line or no red line, Assad has got to go.

    Name me one American that hasn’t always hated Vlad Putin, going back to the 90s. I certainly have, and I’ve never met one American ever that didn’t want to send billions of dollars to Ukraine.

    Anti-Chinese racism has defined America since its beginning! It’s a miracle that our congress hasn’t declared war every year, considering the levels of anti-Chinese sentiment, boiling over all across the heartland.

    If anything the Jews who own the media, are doing all they can to keep a lid on it all. They know how racist Americans are, because they’ve suffered the most. Just look at how racist America lynched innocent Jews like Leo Frank and thousands of others, while chanting ‘Jews killed Christ’. The only reason this news isn’t reported on, is because the media Jews want to protect the racist Americans from any blowback from their victims. So they don’t speak of it, but everyone knows it was your typical American who demanded the war on Iraq, and all the other wars in spite of Jews calling for cooler heads.

    I’m glad to see you’re finally getting this important truth out there.

    • Replies: @A123
    , @Commentator Mike
  295. @geokat62

    Sustained, as-yet unheard of excess mortality trend strikes Switzerland
    https://www.eugyppius.com/p/sustained-as-yet-unheard-of-excess?utm_source=substack&utm_medium=email

    Deaths are soaring in one of the world’s most highly mRNA vaccinated areas [Australia]
    https://alexberenson.substack.com/p/urgent-deaths-are-soaring-in-one/comments?utm_source=profile&utm_medium=reader2

  296. @d dan

    As one of the intelligent and (on UR one has to say “relaively” ) sane and balanced comenters I hope you will stick around while I can still stand a site whose host is afflicted with emotional over certainties despite his scientifically trained intelligence.

    I am one of those who was brought up and remained oblivious to race except for being pleased at the the apparent effects of Ashkenazi and East Asian genes in my clever and good looking young blood relations. I welcome Australia’s multuracialism though not its gestures to multiculturalism. (We should all be educated English speaking moderns without much need to experiment with the number of Africans or Muslim peasabts we can safely import).

    So, can you tell me what you take the egregious Mungo Mumble rain to be? Is he Chinese ethnically? Is he in fact one person?

    We might discuss I think what Australia’s approach to I relations with China should be. 25 million people – like Taiwan – and rightly valuing INO something China doesn’t have, which is a well trained tenured judiciary which doesn’t take orders from overspent or party….

    • Replies: @mulga mumblebrain
  297. @HeebHunter

    Woah, there, HeebH! You sound like a human being with empathy, for once… You feeling okay? I hope it’s not the ‘rona.

    • LOL: Mehen
    • Replies: @HeebHunter
  298. @Wizard of Oz

    The Wiz said to Mr. Unz…

    I hope to get round to weaning g you off the rubbish about Nuland, McCain and other clowns pulling off a coup in Kyiv.

    … never mind that the “rubbish about Nuland” echoed around the world…

    Ever an enthusiast for endless fun and games.

    I say – let the child have his fun.

    • Replies: @Wizard of Oz
    , @Firesail
  299. A123 says: • Website
    @Rurik

    Anti-Chinese racism has defined America since its beginning! It’s a miracle that our congress hasn’t declared war every year, considering the levels of anti-Chinese sentiment, boiling over all across the heartland.

    Do you mean legitimate complaints about CCP exploitation?

    Sure, they have collaborators like Hunter. His dad, Beijing “Big Guy” Biden, got his 10% to place CCP Elites above American workers.

    The simple truth is that the WUHAN-19 virus came from WIV. It may not even be a “leak”. (1)

    Scientists claim they’ve traced original infection back to Wuhan’s ‘ground zero’ – in discovery that challenges lab leak hypothesis

    ….

    concerns started to mount when it emerged the Wuhan Institute of Virology — located just 8miles away on the other side of the Yangtze River — was working extensively on bat coronaviruses at the time.

    This Pekar study is consistent with the WUHAN-19 virus moving from WIV to the Wet Market before it spread to humans. Hmmm….

    Were low paid, non-scientist staff (e.g. security guards, building maintenance) stealing apparently healthy animals slated for destruction? Then, selling them and the Wet Market to pocket a few extra bucks each week?

    This is not a “leak” it is a crime. However, it is a crime that did not understand the risk, and thus unleashed WUHAN-19 on the planet by accident.
    ___

    As bad as the last few years have been, there is huge, long-term upside:

    ♦ Every smart, honest American realizes the CCP is guilty
    ♦ Everyone sees that supply chains to unreliable China are weaknesses
    ♦ Decoupling from CCP exploitation is now inevitable
    ♦ MAGA Reindustrialization will bring good jobs at good wages back to America
    ___

    It will even be good for China.

    The Bourgeoisie CCP Elites will have to stop abusing the Worker Proletariat at home. Imagine how much better most Chinese people will be without the tyrannical reign of privileged, upper class, Beijing Bolshevik Imperialists upon them.

    PEACE 😇
    __________

    (1) https://www.dailymail.co.uk/health/article-11053897/Did-Covid-emerge-notorious-wet-market-Two-explosive-new-studies-suggest-so.html

    • Disagree: MarkU
    • Thanks: Wizard of Oz
    • Troll: mulga mumblebrain
    • Replies: @Rurik
    , @mulga mumblebrain
  300. @Random Anonymous

    No wonder so many readers and commenters have trouble believing he is rational or even sincere about his positions.

    This is something to legitimately wonder about all sorts of pundits, bloggers, medical experts and, of course, politicians, Govt officials, etc. etc.

    I was explaining to a friend recently, who is a big fan of commentator Candace Owens, that she does have some valid positions but, other times I hear her throwing out cheap, confirmatory bait just to get the adoration and approval of the audience.

    I told my friend that this is how Candace makes a living so, given money is involved you have to always factor that motivation regarding anything she says.

    So, I recommend keeping that in mind related to whole range of notable people today. Cui bono?

  301. MarkU says:
    @terraintheory

    And then after that he can investigate flat Earth theory and every other garbage hypothesis that explains nothing, right?

    • Replies: @Rumpelstiltskin
  302. Rurik says:
    @A123

    Anti-Chinese racism has defined America since its beginning!

    Do you mean legitimate complaints about CCP exploitation?

    no, of course not, the hatred all Americans have for China and the Chinese, predates even the landing at Plymouth Rock. Americans have hated the Chinese even before they were Americans.

    Now that the Chinese are giving them Covid, and taking their jobs, and sending plastic trash cans to Walmart that crack as soon as you over-stuff them, we all simply have more reason to hate China.

    Perhaps worst of all, is the way they’re treating the Taiwanese and Hong Kong-ians. How are we Americans supposed to sit here and take that?!

    And then what about the Uyghurs?! Is America just supposed to sit on our hands, while human rights are being violated?! We need to send every Chinaman in America to Gitmo, until they realize that human rights are a non-negotiable, inviolate right!

    USA! USA!!

    The next time I hear that China is attempting to claim sovereignty over a rock in the China sea, I say it’s time for the nukes to fly, and I’m sure every red-blooded American, who loves freedom would agree.

    • LOL: A123
    • Replies: @Etruscan Film Star
  303. @SafeNow

    I can now better understand Ron’s belief that one is best served by printing downloads or buying hardcopy books.

    Digital info in general has an ephemeral quality; the internet is like writing in the sand on the beach at low tide. Valuable info should be archived and backed up.

    A few useful free applications in that regard:

    html (faster, easier):
    Singlefile (firefox plugin) – Save an entire web page—including images and styling—as a single HTML file. https://addons.mozilla.org/en-US/firefox/addon/single-file/

    pdf (more powerful search & annotation options):
    https://www.winnovative-software.com/free-html-to-pdf-converter/
    https://www.weenysoft.com/free-html-to-pdf-converter.html

    • Thanks: meamjojo
  304. @MarkU

    Really? Terrain vs Germ Theory = Spherical vs Flat Earth?

    No. It’s a valid, even vital debate. But it shouldn’t be framed as either/or.

    • Replies: @MarkU
  305. mike99588 says:
    @Weston Waroda

    Vaccination had/has no benefit against adequate invermectin and vitamin D3 prophylaxis even in the deadly Delta wave especially when backed up with early treatment options.
    Even the advertised 83-90% prophylaxis success and 63% early treatment are with seriously unoptimized dosing and formulas.

    Most people did not have timely informaton or supplies even if they were seriously interested. Mainstream was still promoting the idea of Delta being more contagious but less severe when bodies were dropping.3 Then getting ivermectin timely and adequate failed repeatedly.

    Only being prestocked with 1000-2000mg ivermectin was likely to avoid stress, panic or disaster.

  306. Firesail says:
    @Zachary Smith

    Zachary:

    I suggest you consult the VAERS site. There have also been a slew of new studies from a number of countries showing a direct correlation between the number of jabs and the probability of hospitalization and death. 4 jabs= highest hospitalization and death numbers. I personally know several severe adverse reactions and one death of a perfectly healthy teenage boy. This is serious business.

    Pfizer is known for previous frauds and I believe has paid the largest fines. They had never successfully marketed a vaccine previously.

    The data that they were forced to release by a freedom of information demand issued by a judge showed that in the first two months that the “vaccine” was marketed, (12/20- 2/21) they recorded 1,200 deaths and tens of thousands of adverse effects It is shocking that this experimental mRNA substance was not immediately (and still is not) recalled. These numbers are their data!

    Ron’s quote re the number of deaths is a gross overstatement of reality. The average age of mortality for so called covid deaths was 80. They had an average of 2.5 co-morbidities. Most died with covid, not from covid. Hospitals were paid for covid diagnosis, Utilizing respirators, and declaring covid deaths. That was sure to encourage objectivity.

    The reality is the US has loads of bio labs domestically and hidden in other countries. Russia has credibly accused us of being in violation of the Bio weapons Treaty of 1975. Who would have expected that we have 11? (Not sure how many now), in Ukraine of all places, coincidentally the home of Biden family graft.

    It is clear to me that our government is not a reliable source. One must look further. MSM is a sham, ignoring events that conflict with “the narrative”. The government allocated and spent \$1 Billion on “vaccine” promo with major media outlets in the US. Do you this this magnitude of largesse allows for objective reporting? Social media routinely censor, suspend, cancel or de-platform all reports that challenge the narrative.

    Science has always been the process of open debate to prove or disprove given hypothesis. What has happened to science and free speech in this nation?

    I am just getting warmed up, but the information is out there for those who are willing to have eyes wide open.

    • Agree: Mehen, mike99588
    • Replies: @The Real World
  307. geokat62 says:

    • Thanks: IreneAthena
  308. @Ultrafart the Brave

    Thank you for making my point so well for me. One piece od mildly shocking trivia goes round the world an no one notes the words “outreach to Ianukovich” which reflects the tone of the conversation much better.

  309. Firesail says:
    @Ultrafart the Brave

    Wizard:

    If you view the film, Ukraine on Fire, you will see the info on the famous telephone call when Victoria says “fuck the EU!” (Their pick for the next president of Ukraine) because the US had already selected the anti Russian guy to replace the pro-Russian guy they deposed.

    You will see John McCain on a stage exhorting Ukrainian people to rebel against the government.

    Some very revealing info re our role in the 2014 coup.

    • Thanks: Ultrafart the Brave
    • LOL: Wizard of Oz
  310. some_loon says:

    Our host, Ron, decries the focus of alt media on the vax, rather than on Covid origins. Yet, what decision do I have to make that would be different based on from whence this malady came? Only buy ‘made in China’? Vote against someone? Who? Donate to some particular charity? Say bad things about Bolton and Pompeo and other NeoCons instead of Xi or Mao or Deng or some other ChiCom whose name I cannot spell? Choose what color mask to wear on Wednesday? What, exactly, would Ron have me do?

    Where the crud came from, and who brought it about, means little if you are hoping that I can find and fix a target, and thereby heal the world, or at least take revenge on your behalf. Look elsewhere for that. Wherever this came from, I still have to get up every morning and go to work. But the matter of the vax being good or bad very much affects a decision I make.

    I am not of either camp of the doomsayers, so I am not so sure it matters so much if I get the jab and the boosts or not. But to the extent that I am able to evaluate the balance of risks and benefits, I am interested in relevant info as I have to decide something. But where all this comes from does not seem to matter as much.

    So, I think Ron is missing the key idea that all media has an audience, and the members of that audience have their own concerns and needs.

  311. Meimou says:
    @Johan

    At large there are two kind of people, the sheep who obey authorities, and fools which produce far fetched and bizar theories, the latter tend to grow overnight like mushrooms, and they tend of have a contagious effect.

    Most notable anti covid cultist belong to a third group: thoses who document the evidence contradicting the official narrative and act accordingly.

    • Replies: @Johan
  312. MarkU says:
    @Rumpelstiltskin

    Terrain theory claims that pathogenic bacteria and viruses are not disease causing organisms but instead are generated by our bodies to purge themselves of toxins. Sorry but that theory is every bit as retarded as flat earth theory.

    • Replies: @Rumpelstiltskin
  313. “A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere, probably now encompassing some 15-30% of the American population and almost monopolizing online Covid discourse.”

    Oh it’s far higher than 30%, Ron. Over 80% of Americans got the first shot, less than 20% got the fourth shot, and less than 3% of children got ANY shots – because their parents refuse to do it. Confidence in the demonstrably ineffective and poisonous pricks has collapsed – you might say – exponentially in the past year.

  314. @Rurik

    You shouldn’t joke about this as half of what you wrote is absolutely correct.

    • Disagree: Random Anonymous
  315. @Firesail

    Yep, I 100% back you up on everything you wrote.

    Covid = the biggest, global false flag in human history. The phony injections are poison.

  316. @Rurik

    Now that the Chinese are giving them Covid, and taking their jobs, and sending plastic trash cans to Walmart that crack as soon as you over-stuff them, we all simply have more reason to hate China. …

    The next time I hear that China is attempting to claim sovereignty over a rock in the China sea, I say it’s time for the nukes to fly, and I’m sure every red-blooded American, who loves freedom would agree.

    Absolutely. Those defective trash cans are the last straw. Rally ’round the flag! Then cry Rubbermaid and let slip the nukes of war. Freedom is worth any price!

    • Agree: Rurik
  317. g wiltek says:

    Dear Mr Unz.
    figures are now slowly creeping into excess mortality in Europe, almost across the board ito age bands. However the young are dying at a significant rate faster than usual. Put that in you pipe and smoke it! Here a citation from EURO MOMO Bulletin for week 35.
    “EuroMOMO pooled estimates show an elevated level of excess mortality
    This week’s overall pooled EuroMOMO estimates of all-cause mortality for the participating European countries show elevated excess mortality. Since the middle of 2021, the accumulated mortality of the 0-14 years has been increased. The reason for this is unknown, further investigations are necessary”

    Any sane person would immediately ask if the people dying are vaccinated, yes or no. It is going to be very difficult to explain the sudden excess of young people in any other way than as a result of vaccine. But, until they release the stats, or collect them~~ we will of course not know. Going further into the figures, you will see that the number of dead in most other categories are on par with, or exceeding the number of dead in the two previous years, where we had that “terrible pandemic”, let that sink in. This year, in spite of hardly anyone dying from Covid, the number of dead is on par with or exceeding the previous years numbers.

    • Thanks: Ultrafart the Brave, Mehen
  318. @A123

    The CPC has presided over the greatest boost in living standards for the greatest number of people in history, but this slithering, lying, hate-crazed, Zionazi troll declares that they have been ‘exploited’. In the USA, exploited by Judaic financial criminals and their Sabbat Goy accomplices for decades, in total contrast, median wages, adjusted for inflation, have NOT risen for forty years, and the streets are awash with the faeces, urine and drugs of the burgeoning homeless population. Among the Nazi techniques adopted by the Zionazis like this troll, the Big Lie is paramount.

    • Replies: @Wizard of Oz
  319. @Wizard of Oz

    ‘…a well-trained tenured judiciary..’-translating from the gibberish, as Chomsky used to say, a cadre of class warriors, selected from the Right schools, the Right Universities, the Right practises, with the Right opinions, to invent ‘law’ as they see fit, but ALWAYS ensuring that the interests of the ruling elites come FIRST. Bewigged buffoons.When a renegade like Lionel Murphy enters their ranks, his intelligence and integrity blows all their fraudulent ‘precedent’ and inventions out of the water, so much so that he had to be set up and persecuted so that he might not reach Chief Justice and upset the apple-cart of elite privilege entirely. And in the USA ‘judges’ are NAKEDLY appointed according to their ideological acceptability for the party in power. What I really fear is that the Wizz actually believes his own, not very original, bull-dust. That is a tragic thought.

    • Replies: @Wizard of Oz
  320. anastasia says:

    I agree that the anti-vaxxers are putting no focus on the possibility, probability that the virus is truly a bioweapon, or better, not a virus at all, but something manufactured in a lab. Unfortunately, both sides use the word “virus”, when they should be using the word, “poison”. Frankly, it is far more effective to call this thing a “poison”, rather than it is a virus, especially if the authorities are the ones spreading it about..

    But is it the vaccine or the “virus” that is causing blood clots, myocarditis, etc. These are not the usual symptoms and signs of a flu. They certainly can be the consequences of being “poisoned.” Every time an antivaxxer shows that blood clots and myocarditis, etc. are the caused the vaccine, the government comes out and says that the virus causes blood clots andmyocarditis, etc. So no one knows if these maladies are caused by the “virus” or the vaccine, or the result of being “poisoned.”

    Most of the deaths before the vaccine came out can be easily explained. The CDC guidelines had the hospitals all overcalling deaths due to the “virus,” when the particular death had nothing to do with the virus. They did this because the hospitals were given more money to do it to make this diagnosis. They used an unreliable test to do it. Further, this hysteria for ventilators (even China did not use them, so why did we?) was another thing that caused the deaths of many. Those put on ventilators had low blood oxygen, but full pulmonary function. With full pulmonary function, you should not be put on a ventilator. The risk of death with ventilators is 50/50. Virtually 99 percent died who were put on ventilators with Covid. They created the appearance that many were dying, but the funeral parlors saw no increase in the number of deaths. Something very fishy going on before the vaccine came out.

    But after the vaccine came out, was there an increase in the number of deaths. Yes! What did the authority attribute it to. They attributed the increase in deaths to the virus, but most of the dead all took the vaccine, so was it the vaccine or the virus which caused their deaths?

    We will never know. They keep the statistics.

  321. @MarkU

    Well, if you want to force the issue into extreme formulations, then fine. I could frame an equally extreme version of germ theory, saying, ‘The germ is everything, terrain is nothing,’ and then call it retarded, but that wouldn’t shed much light on anything.

    The interesting aspect of the terrain/germ debate is to ask, how important is each? A strong construction of terrain theory would simply be to say, ‘Terrain matters.’ Asking questions like, ‘How much, and through what mechanisms?’ actually would shed some light. That’s how science is done; it’s not done by forcing inquiry into reality into two opposing extreme formulations and then insisting it’s either one or the other.

    [MORE]

    Obviously we all have many microbes present within our bodies that have the potential to cause disease, but are typically somehow held in check, whether by:
    – our immune system
    – by the environmental conditions created for them by our body
    – or something. What?

    Terrain theorists argue that since the time of Bechamp and Pasteur, under the paradigm of patent medicine and Big Pharma, the importance of germs has been over-emphasized and the importance of terrain neglected, to our detriment.

    Do we already know all there is to know where germs and terrain are concerned? No. Who knows what will be revealed by actually engaging the question scientifically? Who knows what sacred cows of ‘science’ will get tipped in the process?

    If you want a good example of just how resistant to science ‘scientists’ can be, because they’re just so sure of what can and can’t be true, read The Body Electric by Robert Becker. I mention this to set up the question, ‘What about pleomorphism?’ It certainly was never taught in any biology class I ever had. Yet, I’ve come across a couple of highly scientifically knowledgeable men arguing that it is real. Do I really know it’s bunk? No.

    Jerry Tennant, Healing is Voltage (great book):

    “The association of finding fungal-like forms in the blood with the development of tumors was reported as long ago as 1840 and has continued to be reported ever since. Although the existence of these forms has generally been denied by most microbiologists and oncologists, the development of the German microscope known as the Ergonom makes these denials no longer credible. This microscope is capable of 15,000 to 40,000 power and allows one to see even viruses in their live state.”

    “A little recognized effect of antibiotics is the formation of bacteria without cell membranes call L-forms or pleomorphic forms.

    Bacteria without cell membranes are largely ignored by medical doctors because they do not grow in a standard culture plate. If a doctor takes a swab of fluid from a wound or a drop of blood and sends it to the lab for culture, it will often come back as “No Growth”. Doctors believe this means that there are no bacteria present. However, bacteria without cell membranes are almost always present.”

    “L-form bacteria also known as L-phase bacteria, L-phase variants or cell wall deficient (CWD) bacteria, are strains of bacteria that lack cell walls They were first isolated in 1935 by Emmy Klieneberger-Nobel, who named them “L-forms” after the Lister Institute in London where she was working. Two types of L-forms are distinguished: unstable L-forms, spheroplasts which are capable of dividing, but can revert to the original morphology and stable L-forms, L-forms which are unable to revert to the original bacteria.”

    “Koch’s postulates are still considered the way to prove or disprove infectious diseases. However, they ignore cell-wall-deficient organisms because they cannot be cultured in the absence of antibiotics or lysozyme! We will discuss shortly the likelihood that they play a role in what isconsidered autoimmune diseases.

    Many scientists and physicians ignore L-forms since they are not part of the usual paradigm of bacteriology.

    Most of the time, slides of bacteria are observed with a bright light microscope at a reasonability low power, e.g. 40× and with a stain. However, L-forms are difficult to see unless you use a phase contrast microscope or a dark-field microscope at 1000 × power. When blood is observed under these conditions, you will always find L-forms present!

    As the voltage and oxygen levels drop in the blood, the L-forms change from spherical to rod-shaped to yeast-shaped to fungal-shaped forms.

    A relatively new microscope has been developed in Germany called the Ergonom microscope. Most microscopes can only achieve 1000 power. This amazing microscope can achieve 40,000 power and see living microorganisms in 3D and color and watch them change from one kind to another! See videos at http://www.grayfieldoptical.com.&#8221;

    Another proponent is Walter Last:
    http://www.health-science-spirit.com/Diseases/Pleomorphic-Microbes.html
    Yes, you can find some ‘far-out’ stuff at that site, but whatever. He certainly had the scientific qualifications to have an informed opinion.

    “Walter Last combines the training and work experience of Research Chemist Biochemist and Toxicologist with that of Practicing Nutritionist and Natural Therapist.

    He was born and grew up in Germany and has held positions in medical institutions at the Universities of Greifswald, Cologne and Munich, working in research and toxicological investigations. He was Chief Forensic Chemist at Cologne and worked at Bio-Science Laboratories in Los Angeles.”

    Anyway, I just post all of this for whomever it may interest. Terrain vs germs is not a hobby horse of mine. Insisting on one or the other seems about as useful to me as taking one side or the other in the ‘Nature vs Nurture’ question.

    The things posted above are open questions, to me. Getting clear on what we don’t know is key to learning.

    • Agree: Mehen
    • Replies: @MarkU
  322. @anastasia

    But is it the vaccine or the “virus” that is causing blood clots, myocarditis, etc. These are not the usual symptoms and signs of a flu. They certainly can be the consequences of being “poisoned.”

    This is a sensible question that, after two years, should be readily resolved.

    I suggest anyone wanting to know the answer to this and many more riveting questions should investigate the work of Dr. Reiner Fuellmich and friends ( https://corona-investigative-committee.com/ ). They have extensive recorded testimony from literally hundreds of subject matter experts from all over the globe to support their position on the matter.

    Every time an antivaxxer shows that blood clots and myocarditis, etc. are the caused the vaccine, the government comes out and says that the virus causes blood clots andmyocarditis, etc. So no one knows if these maladies are caused by the “virus” or the vaccine, or the result of being “poisoned.”

    Yeah we do – we really do.

    Just ask a few courageous funeral directors and embalmers for their experience since after the fake “vaccines” were rolled out (try this, for example – https://naturalnews.com/2022-03-31-embalmers-reveal-covid-vaccinated-bodies-blood-clots.html ).

    Or ask the insurance companies for their professional assessment of the situation ( hint: all-cause mortality has exploded since after the fake “vaccines” were rolled out ).

    Or ask the thousand-or-so elite athletes that are known to have dropped dead over the last year or so – but strangely only those who were injected with the fake “vaccines”. ( Just kidding – we can’t ask them because they’re dead ).

    Just an opinion here – “the government comes out and says” is not a credible source of infformation. That’s a bit like the chickens taking advice from a fox.

  323. g wiltek says:
    @anastasia

    Well that is only half of it.!
    The vaccine can kill or maim you within hours, that is a known fact. Yet you only figure in the stats as vaccinated 14 days AFTER the second shot. So it is entirely possible to get vaccinated, and either get sick or even die from that vaccination, and yet, your vaccination status will be UN-vaccinated, if it happens before 14 days !
    So in short, you can get COVID as a result of the vaccination, or worse, and yet you will appear in the stats as unvaccinated. Many people got Covid after the vaccination and thought they caught it standing in the queue for the jab. Yet many became sick from the jab itself.
    How stupid are we as normal citizens?

    • Agree: Mehen
  324. @The Real World

    Do you mean 2021? Your neighbor cannot possibly have been vaxxed in March 2020.

    • Replies: @The Real World
  325. Though I disagree with Ron Unz with regards to the covid “vaccines”, I concur that the question of the origin of the virus is primordial and the lack of eagerness in the alt-media to ask it baffles me too.

    PS: To those who argue that there is no virus, I can only say that what made me stay at home for almost three weeks seemed very real to me, even if I never felt it as life threatening, and unlike anything I’ve had before.

  326. Ron Unz says:
    @HeebHunter

    Ron Unz…Is trapped in the “institutions” just like every boomer…

    It will be the final straw, and can actually cause a mad max type breakdown, worldwide, since almost every single country, save for a few Catholic ones, have joined in the Hoax. Even Russia. Espcially China.

    Admittedly, my early “boomer” senility severely clouds my mind…

    Because of that disability, I can’t see the obvious reality that the ruling elites of China, America, Russia, Israel, Iran, and almost every other country in the world are secretly allied together in a diabolical plot to exterminate their own populations through deadly vaxxing.

  327. @Patrick McNally

    You’re right, I did mean 2021. Egad, the years are starting to run together with this never-ending nightmare.

    I just saw that the Fifth Circuit Court of Appeals is going to hear the case again related to Biden’s mandate of Covid “vaccines” for federal workers. It simply boggles the mind, given how obvious it is that they don’t work plus they harm and kill many, that the Govt is still going after that.

  328. MarkU says:
    @Rumpelstiltskin

    Anyway, I just post all of this for whomever it may interest. Terrain vs germs is not a hobby horse of mine. Insisting on one or the other seems about as useful to me as taking one side or the other in the ‘Nature vs Nurture’ question.

    Nature V nurture is obviously not an either/or and only a total dolt could imagine that it was.

    The germ theory of disease has been empirically demonstrated over and over again, the connection between certain diseases and pathogenic organisms is simply not deniable. Unless you are talking about some highly attenuated and modified version of ‘Terrain Theory’ with which I am unfamiliar, it is utter and complete nonsense (though I don’t doubt some ‘medical practitioners’ make money out of it) The standard version of ‘Terrain theory’ is this one…

    https://www.drrobertyoung.com/post/the-terrain-theory-vs-the-germ-theory

    Just because people have scientific qualifications doesn’t mean they can’t be cranks, or worse still hucksters who cynically prey on the highly credulous and scientifically uneducated. Anything you want to believe, you can find someone on the internet who is willing to back you up, all with impressive sounding sciency articles complete with links to other people who will back them up.

    If you want to believe that bacteria and viruses are never pathogens but are constructs that the body exudes to purge itself of toxins, there is nothing I can do to stop you, but that doesn’t mean I won’t laugh at your opinions. And if you want to cite articles from websites that include stuff that is (in your own words) far-out, feel free to do so but ask yourself first whether a serious scientist, with a serious hypothesis would deliberately associate their work with what is basically risible garbage.

    As Mark Twain was alleged to have said. ‘It’s easier to fool people than to convince them that they have been fooled’.

    Perhaps also you might want to apply your own arguments to the flat earth hypothesis, why does it have to be either/or? Maybe its a bit flat but also a bit oblate spheroid?

    • Replies: @Rumpelstiltskin
  329. geokat62 says:

    Telegram comment posted by Dr Roger Hodkinson:

    Sweden stops administering Moderna COVID-19 vaccine due to heart infection risk.

    Join 👉 https://t.me/RogerHodkinson

    https://t.me/RogerHodkinson/541

  330. @Ron Unz

    Three things:
    1) Why not? I can’t imagine leaders of any country don’t want Central Bank Digital Currencies, they’re a huge benefit to Govts. So, Covid is one tranche in “The Great Reset” and it has accomplished many things. I do shudder to think what some of the next unleashed steps will be.

    2) Apparently, many smaller countries were coerced into going along because the IMF either threatened cutting them off from future loans, offered them exceptional loans or dramatically reducing existing ones.

    Iran may not be in cahoots with the others but, was merely forced by planted circumstances (the pathogen) to get somewhat onboard until they could discern what they were dealing with.

    3) As far as reduced populations, and speaking specifically about Western nations, again – how is it not to their Govts advantage? Especially considering most deaths were in the very aged. The Govt sponsored programs financially supporting pensioners in those nations are vastly squeezed. For all we know, the created pathogen may not have turned out to be as deadly as they wanted.

    • Agree: Mehen, Rumpelstiltskin
    • Thanks: Passing By
  331. @Ron Unz

    If you don’t speak French, it is worth having someone translate it for you:

  332. Johan says:
    @Meimou

    Cultists?
    People who proceed either by common sense (product of collective historical experience), or by means of facts, or a mix of both, are not ‘cultists’. Cults rely on group-think, and magical thinking (primitivism). Thus only this third group is not cult based.

  333. @MarkU

    “Nature V nurture is obviously not an either/or and only a total dolt could imagine that it was.”

    My, you’re pleasant, aren’t you MarkU?

    Germs vs Terrain is obviously not an either/or and only a total dolt could imagine that it was.

    Is that how I should have addressed you?

    “Just because people have scientific qualifications doesn’t mean they can’t be cranks, or worse still hucksters who cynically prey on the highly credulous and scientifically uneducated.”

    Wow, thanks for that breakthrough insight. It never would have occurred to me.

    “If you want to believe that bacteria and viruses are never pathogens but are constructs that the body exudes to purge itself of toxins”

    Hmm. Where did you pull that out of? Not my words.

    “Perhaps also you might want to apply your own arguments to the flat earth hypothesis, why does it have to be either/or? Maybe its a bit flat but also a bit oblate spheroid?”

    The stupidity is yours from the outset here for conflating something that is clearly not either/or (germs/terrain) to something that clearly is (spherical/flat).

    Both Walter Last and Jerry Tennant demonstrate far more scientific understanding than you do.

    Stick your oblate spheroid up your ass and bugger off, you’re not worth talking to.

  334. Bumpkin says:
    @Ron Unz

    Sure, I’d be very eager to discuss my theories on those podcasts or pretty much any others.

    Have you reached out to the PBD podcast? He has 3.5 million subscribers on his main Valuetainment channel, and recently had on highly controversial guests like Richard Gage, who you are no doubt familiar with, and the recently banned Andrew Tate. He’s not the brightest, but has an audience and appears to want controversial guests lately.

  335. Ron Unz: “… I can’t see the obvious reality that the ruling elites of China, America, Russia, Israel, Iran, and almost every other country in the world are secretly allied together in a diabolical plot to exterminate their own populations through deadly vaxxing. ”

    There are various types of conspiracy theorists, each with his own ecological niche. Some, like Alex Jones, see “globalists” everywhere, controlling everything. Others, like David Icke, see reptilian aliens. Ron Unz sees “rogue neocons”. Really, I guess it just comes down to a matter of taste.

    This mentality just cannot accept that human actions often have disastrous, unforeseen, and unintended consequences. In conspiracy world, everything that happens is because somebody wanted it to happen. Are people dying? Somebody wants them to. Not you, and not me, certainly; but probably that man behind the tree.

    • LOL: Mehen
    • Replies: @mulga mumblebrain
  336. hillaire says:

    Another windy missive from Mr Unz… and as the withered yenta Ayn Rand noted, you can’t explain the obvious to those who have already made up their minds……

    And having called out this nonsense since it began (you don’t kick off a pandemic response with trillions in bail outs to wall street)… I must concur with the old hag…

    Sachs by the way debated Kennedy back in August.. ‘fact check’ that Ron..

  337. geokat62 says:

    Telegram comment posted by EdwardDowd:

    [MORE]

    🚨🚨We had 2 pandemics. The 1st was Covid the 2nd was the “Vaccine”

    Below Weekly Eurostat Data EU for 25-49 ages in 9 countries. Every country’s excess deaths (except Portugal but still excess) was worse than Pre-vaccines.

    We rest our case.

    Prepared by Carlos Alegria & Yuri Nunes of Phinance Technologies. Just 1 chart that is part of a much bigger formal study. Will be on website eventually. Work in progress. Both PHD Physicists.

    @DowdEdward

    https://t.me/DowdEdward/1094

  338. some_loon says:
    @anastasia

    I agree that the anti-vaxxers are putting no focus on the possibility, probability that the virus is truly a bioweapon, or better, not a virus at all, but something mancufactured in a lab.

    Huh?

    I see and hear a lot of speculation, opinion, argument, etc. that it is manmade and a bioweapon. Maybe there is less focus on that aspect of the matter as the origins of whatever it is or isn’t doesn’t tell most of us much that is useful, however interesting it is.

    This is different from the jabs in that regard – no decision I can make changes what Covid is or where it came from, or who did it to us, but I can choose to not to take the jab (clearly the best choice, IMO), and to try to talk someone else out of taking it if I can.

    The ‘anti-vaxxer’ focuses on the jabs because of the perception of preventable harm, but there’s no do-over of any lab-leak or deliberate deployment which have been alleged to have already taken place.

    But I think our host believes vax injuries and deaths to have been few, and that the worst of this unpleasantness is in the past, so I understand his emphasis on origins of Covid, with an eye to see that justice is done, and a repeat prevented.

  339. A123 says: • Website
    @Ron Unz

    I can’t see the obvious reality that the ruling elites of China, America, Russia, Israel, Iran, and almost every other country in the world are secretly allied together in a diabolical plot to exterminate their own populations through deadly vaxxing

    Once again I offer up better sides to reframe the issue.

    ♦ Manda-vaxxers
    ♦ Vaxx-Realists

    You fit the definition of a Vaxx-Realist. You are declining the boosters. You openly state that children should not receive the jab.

    If the “vaxx-ecutioner” theory is right, it is too late. So instead of debating the issue, why not move on to the harm created by Manda-vaxxers. And, the additional damage they will do in the future:

    • How much authoritarian government is now locked in?
    • How many lost their jobs for refusing the mRNA experiment?
    • How much language learning have children permanently lost to masking?
    • How much will children continue to lose via online classes?

    Manda-vaxxers are much more capable of future harm. These nutters still want mandatory masks. (1)

    House Republicans have asked the Biden administration to explain why it continues to require mask mandates for toddlers as young as 2 years old within the federal Head Start program even as coronavirus cases recede nationally.

    “Forcing a toddler to wear a mask all day isn’t just bad policy, it’s detrimental to a child’s development,” Rep. Michael Cloud of Texas, a senior member of the Oversight panel, told Fox News Digital. “The Biden administration’s decision to mandate low-income toddlers wear masks in school will undoubtedly hinder their learning and damage children’s social development at an incredibly critical age.”

    It should be clear that authoritarian Manda-vaxxers are much more toxic than libertarian Anti-vaxxers.

    PEACE 😇
    __________

    (1) https://www.foxnews.com/politics/republicans-ask-why-biden-still-requires-masks-head-start-toddlers

    • Thanks: some_loon
  340. @Ron Unz

    I can’t see the obvious reality that the ruling elites of China, America, Russia, Israel, Iran, and almost every other country in the world are secretly allied together in a diabolical plot to exterminate their own populations through deadly vaxxing.

    Disregarding the manipulative framing of the issue, just a little brainstorming about how & why international collusion on an alarming scale might be feasible:

    The Network of Global Corporate Control
    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0025995

    The One Bank
    https://web.archive.org/web/20131030214545/http://www.bullionbullscanada.com/intl-commentary/26287-the-one-bank

    Richest 1% will own more than other 99% put together by next year, Oxfam warns
    http://www.dailymail.co.uk/news/article-2915748/Richest-1-world-s-population-99-year-unless-rise-inequality-checked-Oxfam-warns.html

  341. @mulga mumblebrain

    Oh dear. Hard to disagree with this limited slice of information about our vale of tears. Thank G for the lucky country affording some relative cheer.

  342. @mulga mumblebrain

    I am very far from what I have sent, questioned and studied in the US. But if you are pro Lionel Murphy I haven’t time to compile the reading list you need yo put you right. I seem to remember Sir George Lush was one of those who found serious stuff against him. I had become a friend of his a respected his intellect and absolute integrity. I had never heard that there was any prospect of Murphy being CJ. Who would have appointed him? Whitlam made him a judge to get his embarrassing presence out od his Cabinet. Do you remember is ASIO raid?

    • Replies: @mulga mumblebrain
  343. @Wizard of Oz

    Yes, indeed. ASIO, a group that answers to and serves more properly to the Five Eyes and NOT Australia, certainly not under a Whitlam Government, had been misbehaving regarding Ustasha terrorists resident in the country, and enjoying Liberal Party and elite protection as good ‘anti-communists’. So Murphy, the Attorney-General took matters into his own hands.
    It was a good illustration of how fraudulent ‘democracy’ is in this country. We are an oligarchy, a kakastocracy, and a pathocracy, where the institutions of power are all loyal to the US Empire and the Five Eyes Anglosphere Herrenvolk, as, plainly, are you. I can guess who Lush (by name and nature?) voted for, too.

  344. @Ron Unz

    https://www.afr.com/world/europe/putin-has-a-new-opposition-and-it-s-furious-at-defeat-in-ukraine-20220913-p5bhm5

    Oh, I give up. Learn something by finding this on Meduza if necessary. Reliable info on Russian failure from Russian nationalists.

    • Replies: @mulga mumblebrain
  345. Here we go again with this utter nonsense. No Ron, millions of people did not die from COVID. This is a lie and it has been debunked over and over. Somehow he keeps on rambling about it!
    I wonder what his motivations are How many clot shots did you get Ron? It sure has destroyed your brain cells.
    As my grandma used to say, never trust the Jew.

    • Replies: @Ultrafart the Brave
  346. @Rumpelstiltskin

    Ron Unz has contributed positively and undeniably to the cause of the Truth. And he doesn’t attack people who refuse the Vax. He is just a stubborn boomer.

    Now, on the topic of empathy. It is easy to lose oneself reading a comment from an angloid or a kike shill, like A123 here. If you do get angry hearing angloid and kike lies on a daily basis, I do not think you are human.

  347. @Wizard of Oz

    Russian ‘nationalists’. That is Russian fascists, fascists being the USA’s go to guys around the world as stooges. Like Mr. 1% popularity, the racist, nationalist, fascist, drunkard and dope fiend, Navalny, this type instantly appeal to the USA and Imperial boot-lickers like The Wizz. The AFR, ‘The Fin’ is an hard Right Austfailian rag for the parasite class that, as with ALL the Austfailian MSM sewer and the corpse maggot ‘journalists’ therein, is 100% Imperial agit-prop.

    • Replies: @Wizard of Oz
  348. @Dr. Robert Morgan

    Are the Chinese vaccines, Sinovac and Sinopharm not traditional vaccines, with attenuated live or dead viruses used, thus endowing polyclonal antibody protection, unlike the Western vaccines which ‘target’ (ie induce)the cytotoxic spike protein only? Have you read of Ralph Baric’s ‘research’ into the ways that coronaviruses induce myocarditis and cardiomyopathy in rabbits?

  349. Blubb says:
    @Ron Unz

    That is very stupid. The FDA already released data 15 years ago that showed that getting your flu shot three years in a row increases your risk of dying from the flu. Hence why I stopped getting them. Also even at their best, they only have a 15% effectiveness.

    Regarding Covid, I know zero people who died from it. But I know two who died from the shot. Plus at our pediatrician’s, an eight year old died after the shot, hence why she isn’t giving it any more.

    I generally appreciate your writing and this site in general, but you truly seem to be a total vaxtard. Well, to err is human.

    • Replies: @Wizard of Oz
  350. JdL says: • Website

    “A huge and militant anti-vaxxing movement has suddenly appeared from almost nowhere.”

    What an ignorant statement! The vast majority of those of us who refuse the Covid “vaccine” are not opposed to vaccines in general; we’re only against this particular barely-tested and deadly concoction. Are you completely unaware of the fact that the efficacy turns negative within a few months? Are you blind to all the young athletes dropping dead on the field? Or the huge pool of people who are still alive but who can barely function after getting jabbed?

    I had some respect for the Unz Review, but a column such as this can change that perception in a heartbeat.

  351. @Eugène Mazamba

    I wonder what his motivations are How many clot shots did you get Ron? It sure has destroyed your brain cells.

    Your position on this subject is impeccable, but I still think you’re being a bit hard on Mr.Unz.

    Let’s be clear – Mr. Unz is as susceptible to the psychology of the paradigm as any of us. We’ve all fallen into the trap at one time or another – being so invested in a particular belief or expectation or world view that we are physically unable to register conflicting information.

    On this particular subject, Mr. Unz has been caught standing at a moment in time while a literal war for the world is raging around us. He did some good research into the genesis of the alleged Corona Chan “pandemic”, but can’t seem to accept that there are dark forces out there that have a far more diabolical and far-reaching agenda than just this inital campaign.

    • Replies: @Ultrafart the Brave
  352. @Ultrafart the Brave

    … just an addendum to the topic of the paradigm – here’s an expose of some of the Australian government legislation regarding the administration of a Class 4 Poison (namely, the COVID 19 “vaccines”)…



    Video Link

    None of this is hyperbole or fabrication – these are Australian government documents from Australian government websites detailing official government policies.

    I for one have absolutely no problem accepting these facts and their implications at face value.

    I suspect Mr. Unz might be obliged to engage in some intellectual acrobatics to deal with this information while maintaining his stance on the topic – or otherwise just ignore it. That’s the power of the paradigm.

  353. g wiltek says:

    Some seem to think that there can be no conspiracy to enslave and subdue the world’s population.
    To those I would just say look at Davos, what the WEF (world economic forum) discusses, who is there, and what positions they have. Look at the WHO (World Health Organization), the UN (united nations) , the IMF (international Monetary fund), the BIS (Bank for International Settlements), the Royal Emperial College of London and specifically Ferguson, who largely funded by Bill Gates, was one of the “experts” who predicted millions of dead from Covid. This incompetent fool was also involved in slaughtering 6 million healthy animals to fight foot and mouth disease in the UK, and he has got his mathematical models 1000 % wrong, yet he is still employed, and he is still funded by Bill Gates.
    Now, to anyone who cannot start getting suspicious about this, I would like to ask, what on earth do you think these guys are doing? Getting together to drink tea? That’s it?

    Apart from this, there is also direct bribing taking place, like this, where IMF offered money for a country to introduce mask mandate, lockdowns and vaccine: https://www.sott.net/article/441060-Belarusian-President-Lukashenko-says-IMF-offered-nearly-1-billion-USD-bribe-to-impose-Covid-19-lockdown
    In south Africa, President Ramaphosa is involved in a scandal involving 8 million US Dollars in cash hidden in furniture on his farm. I have a good idea of where it comes from, he has just gone to USA again, to discuss IMF involvement in providing loans possibly to buy even more useless vaccines, which the population in that country by and large rejects flat out, and they have done absolutely fine.

    Look up Klaus Schwab, and his book, the Great Reset, look up Agenda 2030 and start connecting the dots!

    And, after that, if you don’t get it, there is no hope. Cognitive dissonance. Failure to see the obvious, because it goes against what you have been told over a lifetime. It it real, and it makes people r e a l l y!!!! s l o w.

    • Agree: Ultrafart the Brave
  354. The Drumbeats of War, Climate Change, the false flag of the COVID19 Pandemic/Monkey Pox/SPARS, and Cyberattacks are used to instill fear and Cover up the Bankruptcy of Global Corporate Government and the impending Global Currency Reset.
    https://twitter.com/NestorBAguilar3/status/1438032139438604289

  355. Today, Thursday 15 September the Daily Mail published a hostile covid article,

    “Fury as The Lancet sensationally claims Covid may have leaked from an AMERICAN lab – echoing anti-western claims peddled by Beijing”

    https://www.dailymail.co.uk/health/article-11214761/Fury-Chinas-puppet-Lancet-sensationally-claims-Covid-leaked-laboratory.html

    Commentators seem confused about the issues.

    • Thanks: Ron Unz
    • Replies: @A123
  356. A123 says: • Website
    @Indignant of Maidstone

    Today, Thursday 15 September the Daily Mail published a hostile covid article,

    “Fury as The Lancet sensationally claims Covid may have leaked from an AMERICAN lab – echoing anti-western claims peddled by Beijing”

    https://www.dailymail.co.uk/health/article-11214761/Fury-Chinas-puppet-Lancet-sensationally-claims-Covid-leaked-laboratory.html

    Commentators seem confused about the issues.

    If you play the clip the exact quote is “US lab biotechnology”.

    How is the French lab biotechnology at WIV different from US lab biotechnology?

    Also, it is highly probable that the Eco Health Alliance transferred “US lab biotechnology” to WIV as part of the coronavirus Gain of Function research they sponsored.

    Everything Sachs states is:
        • 100% consistent with WIV as Origin
        • Implies the U.S. cover-up is about concealing ties with WIV
    _____

    He also says “It is a blunder of biotech”.

    If there is a U.S. lab “blunder” or “leak”, how did it get to Wuhan, China without infecting one or more intermediate locations?

    Any smart, honest interpretation of a “blunder” impacting Wuhan strongly suggests that Sachs believes a laboratory in Wuhan is responsible.

    Further evidence of Sachs interest in Wuhan may be found here: (1)

    A call for an independent inquiry into the origin of the SARS-CoV-2 virus

    A broad spectrum of coronavirus research work was done not only in Wuhan (including groups at Wuhan University and the Wuhan CDC, as well as WIV)

    The NIH could say more about the possible role of its grantees in the emergence of SARS-CoV-2, yet the agency has failed to reveal to the public the possibility that SARS-CoV-2 emerged from a research-associated event, even though several researchers raised that concern on February 1, 2020

    Given the impossibility of a U.S. location “SARS-CoV-2 research-associated event” reaching Wuhan, Jeffery Sachs is again clearly pointing his finger at WIV as Origin.

    PEACE 😇
    __________

    (1) https://www.pnas.org/doi/10.1073/pnas.2202769119

    • Troll: mulga mumblebrain
  357. @HeebHunter

    If you do[n’t] get angry hearing angloid and kike lies on a daily basis, I do not think you are human.

    Sure, it’s infuriating. But I don’t get the sense that your burn-it-all-down messaging would at all displease the ordo ab chao Hegelian/polarization dialectic crowd. You know, the ones that ground Germany into the dirt. If I were tasked to pick an avatar for you, something like this leaps to mind:But whatever. I was just goofing with you. Carry on.

    • LOL: Rurik
    • Replies: @HeebHunter
  358. g wiltek: “Some seem to think that there can be no conspiracy to enslave and subdue the world’s population. … Look up Klaus Schwab, and his book, the Great Reset, look up Agenda 2030 and start connecting the dots!”

    This, of course, is the conspiracy theorist’s stock-in-trade. “Look!” he cries. “The rich are planning for the future! Read these books and you will see what they’ve got planned for us!”

    But what’s surprising about that? Of course the rich are planning for the future. They do it all the time. That’s why they’re rich! No doubt they fully intend to stay that way, and trying to foresee future developments is an important part of that. But that doesn’t mean there’s a conspiracy and they’re the ringleaders. The future will happen anyway, and the technological system will “progress” to its conclusion regardless of whether they want it to move in any particular direction or not.

    As a thought experiment, let’s suppose that both Klaus Schwab and Bill Gates decide to give away all their wealth and become penniless beggars. Will that stop “Progress”? Will the future hold no further “progress” in automation, AI, and robots? Will viruses, either from zoonotic spillover or bio-engineering, pose no further threat to mankind? Of course not! It would merely be that others would take their place.

    The conspiracy theorist plays on the popular misunderstanding that it’s individual people who drive technological progress, and that they have the “free will” not to do so if they so choose. While in some theoretical sense that’s doubtless true — if everyone, everywhere, simultaneously decided permanently to renounce technology and return to primitive ways of doing things, “Progress” would stop — there’s no chance of it happening. In fact, it’s the other way around. Technological “progress” drives people to do things they otherwise might not or need not do. For example, “progress” in science has led to an understanding of viruses, and that understanding has quite accidentally led to the realization that such things can be used as weapons. Because it’s now understood very well that viruses can be made into weapons, this necessitates additional research into vaccines, and because the vaccines themselves have side effects, this necessitates still more research into how to correct those side effects, which will lead to still more side effects and efforts to correct those, and so on, ad infinitum. Even worse, in order to produce vaccines against a virus, you first need to create that virus, and human fallibility being what it is, that makes the occasional laboratory accident inevitable. The Covid-19 pandemic very likely came from a laboratory engaged precisely in that kind of research. But in a world in which bio-weapons are the poor man’s nuclear bomb, and “progress” in technology has placed their production in the hands of small states and even individuals, such research must be done. The periodic loss of millions of lives in man-created pandemics is just a price we pay for “Progress”. Get used to it!

  359. Mehen says:

    Brief remarks on a sensational study from Lombardy, which finds conclusive evidence of SARS-2 infection in a patient sample from 12 September 2019.

    https://www.eugyppius.com/p/every-day-there-is-more-evidence

    • Replies: @Allergic2katz
  360. niceland says:

    It seems the Lancet is stirring things up by backing it’s committee and Mr. Sachs claims. And now the U.K – Telegraph publishes:


    Major Covid report suggests virus could have leaked from a US lab

    The Lancet’s paper said it is ‘feasible’ that Sars-Cov-2 emerged from a natural spillover or a lab incident, but elements provoke backlash

    https://www.telegraph.co.uk/global-health/science-and-disease/backlash-major-covid-origins-report-suggests-virus-could-have/

    • Replies: @Ron Unz
    , @A123
  361. geokat62 says:

    Excerpt from Dr Robert Malone’s latest article, (Not so) “Safe and Effective”:

    This publication covers a re-analysis of the original Pfizer and Moderna clinical trial data by a very experienced team of investigator/authors. By using more traditional methods of calculating the clinical trial data, the study authors found that the mRNA vaccines were associated with an excess risk of serious adverse events of special interest of 12.5 per 10,000 vaccinated.

    What does this mean? A simple calculation shows that
    10,000 vaccinated people divided by 12.5 people with serious adverse events =(10,000/12.5 = 800)

    That means 1 in 800 young adults in the original clinical trial suffered a serious adverse event.

    https://rwmalonemd.substack.com/p/not-so-safe-and-effective

  362. Ron Unz says:
    @niceland

    It seems the Lancet is stirring things up by backing it’s committee and Mr. Sachs claims. And now the U.K – Telegraph publishes:

    Yes, and the Daily Mail piece that someone had linked upthread is even more dramatic. Here’s its headline:

    “Fury as The Lancet sensationally claims Covid may have leaked from an AMERICAN lab – echoing anti-western claims peddled by Beijing”

    https://www.dailymail.co.uk/health/article-11214761/Fury-Chinas-puppet-Lancet-sensationally-claims-Covid-leaked-laboratory.html

    However, there’s something extremely odd about the situation…

    I sat down and carefully read the entire 50,000 word Lancet Report. Virtually none of it is at all controversial. It’s about as mainstream and respectable as you can get, and it never once suggests that Covid came from a US lab. So the Daily Mail article was denouncing the report for something it didn’t even say.

    https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(22)01585-9/fulltext

    I suspect Intelligence operatives had become very nervous due to Sachs’ public statements over the last couple of months and feared what would be in the Lancet report. So they prepared a ferocious attack and got the Daily Mail to run it immediately, before anyone had had a chance to read the extremely long text. They felt they had to get out the earliest spin, but they shot themselves in the foot by attacking the report for something it never said.

    It’s like a criminal with a very guilty conscience being asked an innocuous question about something and responding with a huge list of fierce denials about his hidden crimes, thereby attracting sudden suspicion.

    “The guilty flee when no man pursueth”

    • Thanks: niceland
    • Replies: @Wizard of Oz
    , @Antiwar7
  363. A123 says: • Website
    @niceland

    It seems the Lancet is stirring things up by backing it’s committee and Mr. Sachs claims against WIV. It is OBVIOUS that Sachs is fingering WIV as Origin. For some reason he is not allowed to explicitly declare the TRUTH about WIV.

    If you want any smart, honest person to believe a U.S. “leak” or “blunder” reached Wuhan — Explain in detail how the virus traveled from:

        • U.S. lab to
        • U.S. Airport, to
        • CCP customs port, to
        • Wuhan

    Sachs is disseminating a carefully coded message that:
        ♦ WIV is Origin, and
        ♦ He cannot state so openly

    Christmas lights are like Jeffery Sachs… They do not hang themselves. There are obvious, justifiable reasons why Sachs is unwilling to cross Killary and Beijing Biden.

    PEACE 😇

     

    • Replies: @Ron Unz
  364. @mulga mumblebrain

    No, Russian fascistic nationalists (OK Navalny might be one of the milder variety) who are betraying their barbaric genocidal thinking in the course of giving away incidentally the weakness of Russia’s armed forces.

    • Replies: @mulga mumblebrain
  365. @Ron Unz

    Or maybe some enterprising Daily Mail journalist has an unloved source, largely neglected because of its threadster and even contributor ravers, but often made interesting by theclever need that owns it .

  366. Ron Unz says:
    @A123

    It is OBVIOUS that Sachs is fingering WIV as Origin.

    I don’t think I see what you see, and neither does anyone else. Just take a look at the Daily Mail article, filled with bitter attacks against Sachs and the Lancet report for allegedly claiming that Covid was produced in an American lab:

    https://www.dailymail.co.uk/health/article-11214761/Fury-Chinas-puppet-Lancet-sensationally-claims-Covid-leaked-laboratory.html

    An article on ZeroHedge suggests the same thing:

    https://www.zerohedge.com/covid-19/lancet-opens-pandoras-box-suggests-covid-could-have-originated-us-labs

    I’ve read the full 50,000 word report, and it does NOT say that. But it also most certainly does not suggest Covid came from the Wuhan lab either.

    There’s not the slightest indication that Sachs believed Covid came from the Wuhan lab, and a huge number of people denouncing and attacking Sachs say he believes it came from an American lab. Me, I don’t know—Sachs is being pretty cagey on the issue, which is the right strategy to follow.

    But unless you’re Sachs himself commenting under a pen-name, it’s ridiculous for you to be sure he believes it came from the WIV.

    • LOL: A123
  367. @Blubb

    I would guess that the FDA may have noted that old people who always had their annual flu shots were more likely to die of flu than young people who only had one or two shots. Right,? Ron?

    • Replies: @Ultrafart the Brave
  368. A123: “It is OBVIOUS that Sachs is fingering WIV as Origin. ”

    I’d phrase it less strongly. I’d say that it’s obvious Sachs thinks it reasonable to suspect WIV as the source of the leak, but that it could well also be that American funding and help was required for WIV to have been working on this virus at all. The money quote is in the Current Affairs interview:

    SACHS:

    We know that at the Wuhan Institute of Virology, the scientists there had been trained by American scientists to use advanced bioengineering methodologies. And in particular, we have scientists in North Carolina, Texas, and so forth who do this kind of research, believe in it, argue for it, and say that they don’t want any regulations on it and so on. And they were in close contact with Wuhan Institute of Virology, and they were part of a joint research group that was stitched together by something called EcoHealth Alliance. And EcoHealth Alliance was the kind of marriage maker between the American scientists and the Chinese scientists. That was the vehicle for funding from the U.S. government, especially from the National Institutes of Health, and especially from Tony Fauci’s unit, the NIAID. There were years of grants, there were grant proposals. We don’t know exactly what was done. But we have enough reason to know that we should be asking exactly what was done. And we know definitively that from the beginning, NIH has been running from telling us what has been done. They’re not telling us the truth, that they had reason to fear from the start that this came out of a lab. And that to this day, they have reason to suspect it, but they’re not talking.

    The picture he paints is that both China and the US are engaging in GOF research and now are trying to cover up that fact, frustrating efforts to get to the truth about the pandemic’s origins. If that’s true, it’s clear they both have something to hide. Further, if it’s true both countries bear responsibility for the 18 million deaths so far, and now that the disease is endemic, however many millions more into the future, it’s no surprise that they don’t want to take the blame.

    Nevertheless, his call for transparency seems more than a little naïve. Because of the state of the technology, research like this is necessary and can’t be banned or even regulated. That would only drive it underground, and that would benefit neither side. Thus, both sides have an interest in steering any inquiries away from the truth.

    • Thanks: A123
    • Replies: @A123
    , @Tony Hall
  369. @Ron Unz

    For want of a better place let me draw your attention here to

    https://www.counterpunch.org/2022/09/15/russias-underperforming-military-and-our-own/

    I seem to remember you approving of Andrew Bacevic in times past so this may interest you.

    • Replies: @mulga mumblebrain
  370. @Wizard of Oz

    I would guess that the FDA may have noted that…

    Notwithstanding involvement in forum mayhem and mischief, we all know you are better than this.

    That line is akin to plucking a gold coin (current spot price ~\$2,400 AUD/oz) out of a sparrow’s arse as it flies past your picnic (far preferable to extracting 1a 2.5 kg silver bar out of the same tiny orifice).

    Granted, pretty much anything the FDA publicly discloses is a load of lying codswallop, so we’re all left to guess exactly what their secret considerations might actually be.

    But that consigns any undocumented speculation as to what the FDA is up to and most especially what they are thinking to just that – pure unfounded speculation.

    I’d be much more inclined to speculate what they might be thinking as they are tied to poles and blindfolded in preparation for their public execution by firing squad. At least then we’d have some satisfaction alongside the effort of imagining.

    • Replies: @Wizard of Oz
  371. @Wizard of Oz

    The author, Michael Schuman of that ilk, is a ‘Fellow’ at the Atlantic Council, ie NATO, the implacable race and civilizational enemy of China and the entire non-Western world. Sort of like the Wizz but with more polished credentials. ‘He would say that, wouldn’t he’, as Mandy Rice Crispies said.
    We are in the throes of World War III, a race and civilizational struggle to DESTROY China and set it back decades, or centuries, so that the Wizz and the other Western Herrenvolk can reign over us, forever and ever, amen, just as ‘God’ ordained.

    • Troll: Wizard of Oz
  372. @Wizard of Oz

    A tiny part of the Russian military, much of the fighting done by local Donbass militia and the Wagner private forces, taking care not to kill civilians needlessly. At this stage in the illegal US aggression in Iraq, the US and its stooges like Austfailia, had murdered over one million Iraqis, and I bet the Wizz was quite tipsy with joy and displaced martial ardour.

    • Replies: @Wizard of Oz
  373. @Rumpelstiltskin

    Joker did what he set out to do the movie, you know? He should have been way harhser tbh. The city literally represents globohomo and batman is ZOG.

  374. @Wizard of Oz

    Navalny may be a ‘mild’ nationalist racist, but only by your standards, Wizz. I bet you were at the SCG in 1971, cheering the Wallabies and Springboks on in the rugby test.

    • Troll: Wizard of Oz
  375. A123 says: • Website
    @Ron Unz

    Lets go back a step.

    What are the Rules of Engagement for understanding what other people say?

    -1- Exactly what they say and no more?
    -2- Reasonable inferences can be made?

    [MORE]

    ===================================

    -1- EXACT

    To the best of my knowledge I have never seen a Sachs quote featuring descriptions like “intentional” or “attack”.

    Instead Sachs has exclusively used terms that would be associated with unintended release such as “blunder”. Or, in scientific terminology from the PNAS article “SARS-CoV-2 research-associated event”.

    If you believe EXACT is the correct standard. Please explain how a “blunder” at a U.S. lab:

    • Crossed the Atlantic
    •• Travelled inland to Wuhan
    ••• Started “Patient Zero” at the Wet Market

    To me a “blunder” crossing the Atlantic seems exceedingly implausible.
    ___

    Now let us examine Sachs’s exact phrase from the Daily Mail video. The quote is “US lab biotechnology” not “U.S. laboratory”.

    It seems highly plausible that Eco Health Alliance transferred “US lab biotechnology” to WIV as part of the coronavirus Gain of Function research they sponsored.

    Thus what Sachs precisely says is 100% consistent with WIV as Origin.

    ===================================

    -2- INFERENCE

    What pressures could be on Sachs?

    He is an Economics professor tied to Columbia university. What bias exists among senior academics at Columbia? (1)

    At other schools we found these representations of registered faculty Democrats to Republicans:
    Brown 30-1
    Bowdoin, Wellesley 23-1
    Swarthmore 21-1
    Amherst, Bates 18-1
    Columbia, Yale 14-1
    Pennsylvania, Tufts, UCLA and Berkeley 12-1

    Assuming Sachs is willing to separate from Columbia, how about the field of Economics in general? (2)

     

     

    Economics is only 550% DNC left leaning, which is better than Columbia at 1400%. However, it is still a big risk if he says something disliked by the establishment. Is it not unreasonable to infer that Sachs has personal reasons to stay on the “good side” of academia and the DNC?

    If Sachs believes that “Rogue GOP NeoCons” are responsible. He could shout that loudly from the rooftops and be hailed as a hero by the establishment at Columbia University and other DNC aligned institutions.

    Given ties between WIV and Elite U.S. institutions Sachs has strong motivation to avoid directly fingering WIV. The blowback from that would negatively impact individuals in his social peer group.

    Where does that leave us on INFERENCE:

    • Sachs has released work that 100% consistent with WIV as Origin
    •• Sachs work is exclusive to an unintentional release
    ••• Sachs has not challenged “Patient Zero” at Wuhan

    For personal reasons he cannot come out and say “WIV did it, and Elite U.S. Universities helped”. However, combining those three things is pretty much the proverbial smoking gun pointed at WIV.

    PEACE 😇
    __________

    (1) https://studentsforacademicfreedom.org/reports/political-bias-in-the-administrations-and-faculties-of-32-elite-colleges-and-universities/

    (2) https://www.nas.org/academic-questions/31/2/homogenous_the_political_affiliations_of_elite_liberal_arts_college_faculty

    • Thanks: Wizard of Oz
  376. @HeebHunter

    Ron Unz has contributed positively and undeniably to the cause of the Truth. And he doesn’t attack people who refuse the Vax. He is just a stubborn boomer.

    I suppose I have to agree with you. I held Unz in high esteem prior to Covid, but obviously I’m more critical now. Still, if had to put his overall Covid track record on the scales and weigh it, I guess it comes out positive as long as he stays away from censorship, since he provides a platform for truth to get out.

    Yes, it might seem like a bit of a grotesque spectacle, but if I think of it as performance art it’s masterful, really. Unassailably ensconced in the mainstream narrative, he nonetheless goads and prods ‘anti-vaxxers’ into providing the latest updates on the jab horror show. In fact, I can even imagine that his increasingly frequent pot-stirring indicates the urgency he feels to get their message out.

    Not just anyone has the nerve for such an approach. I guess I see it this way:

    [MORE]

    ………….IF YOU THOUGHT JUMPING THE COVID SHARK
    …………………….WAS A THRILLING FEAT
    …………………………WAIT TIL YOU SEE
    UNZIE ATTEMPT TO OUTSURF THE CRASHING NARRATIVE
    ………………..(HE JUST MIGHT SUCCEED!!!)

    • Replies: @Rumpelstiltskin
  377. @Ultrafart the Brave

    Beyond wour waffle do you actually know anything relevant? Do you even know how FOIA applies to the FDA and what inquiries have been made?

    You may have discerned that I don’t trust the inferences the Commenter purported to draw from what he allegedly got from FDA information. Would you like to say something about that and thus show you had some idea of the point I was clearly raising?

    • Replies: @Ultrafart the Brave
  378. @Ron Unz

    And….. Ron

    If you have given up on your early favourites Scott Ritter and Larry C. Johnson you might find it worth considering what Lt-Gen Ben Hosges has to say in this long interview. He seems to me to know what he is talking about and not blurting out confident opinions without mature circumspection.

    [MORE]

    Watch “Russia’s War in Ukraine: The Evolving Military & Strategic Situation (with Lt. Gen Ben Hodges)” on YouTube

  379. g wiltek says:

    OK, so the vaccine was most likely an American concoction.! So sort Mr Fraudci out, if any one deserves it, he certainly does.
    But it still leaves the vaccine to do the job.
    Normally about 25 athletes die from heart attack in a year. Since the vaccine, it is now close to 1000. That is well over a 2000% increase. That’s right. TWO THOUSAND!plus!
    But, sure, that could be a coincidence, if you are simpleminded enough.

    https://www.sott.net/article/472170-Nearly-900-young-healthy-athletes-confirmed-dead-in-18-months-as-British-Heart-Foundation-releases-ad-normalizing-heart-attacks-in-children

    • Thanks: Mehen
    • Replies: @mulga mumblebrain
  380. @mulga mumblebrain

    One of your typical brainfarts as you ignore the fact that I never favoured the 2003 Iraq war and throw in the totally deranged idea that Americans (because the fighting forces were almost entirely American) killed a million Iraqis in about the first six months.

  381. A123 says: • Website
    @Dr. Robert Morgan

    A123: “It is OBVIOUS that Sachs is fingering WIV as Origin. ”

    I’d phrase it less strongly. I’d say that it’s obvious Sachs thinks it reasonable to suspect WIV as the source of the leak, but that it could well also be that American funding and help was required for WIV to have been working on this virus at all.

    That is a reasonable conclusion.

    There is some sort of cognitive capture with Mr. Unz. He has become so wedded to the Rogue NeoCon theory that he cannot look at anything else. I suggest Sachs is *being cagey* because he does not want to offend his peers. For personal reasons Sachs cannot come out and say “WIV did it, and Elite U.S. Universities helped”. Mr. Unz finds this highly plausible idea unfathomable.

    Sachs never uses “attack”, “intentional”, or any other verbiage suggesting a deliberate act. Yet Mr. Unz finds that Sachs is *being cagey* in support for the Rogue NeoCon grand conspiracy. The problem is — Columbia professor Sachs has no reason to *be cagey* if he believes NeoCons in Trump’s administration are responsible. Blaming Trump would make Sachs a hero, not a pariah.

    PEACE 😇

    • Troll: mulga mumblebrain
  382. Antiwar7 says:
    @Ron Unz

    It’s incredible! The executive summary of the report says nothing about the origin of Covid, and even explicitly says there were no virologists writing the report.

    And yet our national security state launches a pre-emptive attack through the Daily Mail against the report, talking about how it’s ask wrong about the origins. What another clear tell! It obviously shows they have something to hide.

    • Replies: @Antiwar7
  383. Ron Unz says:
    @Wizard of Oz

    If you have given up on your early favourites Scott Ritter and Larry C. Johnson

    It really isn’t good behavior to derail this thread into a discussion of the Ukraine war or Putin’s policies, which is obviously off-topic here. There are plenty of other places on this website for you to comment on those topics.

    You’re an extremely gullible individual who just a few months ago was informing everyone that Putin was dying from cancer. If you keep up this bad behavior, your comments may get trashed.

  384. Mehen says:

    This page contains a reference list of credentialed experts and freedom warriors that have earnt the right to voice an opinion on the pandemic and the “public health” response.
    Each link will take you to a page containing an updated list their interviews and other relevant links.

    https://totalityofevidence.com/resources/experts/

    • Thanks: Rumpelstiltskin
  385. Tony Hall says:
    @Dr. Robert Morgan

    Surely by now its pretty obvious that there has been a significant amount of overt and covert interaction between China-based and US-based scientists, financiers and politicians in the making of the manufactured COVID crisis. We are long past the point where it makes any sense to attribute the coronavirus controversy to a simple animosity of one superpower against another. The evidence is copious that one or more agendas were set into motion by a coalition of factions based in both China and the USA. Moreover, there is no basis for dismissing the possibility that agents from, for instance, Israel, Canada, France, Russia, US-ruled Eurasia (including Ukraine), UK, India and other biowweapons polities (including some corporations?) were also involved.

    In the winter of 2020 before any “pandemic” was declared, I was already busily engaged in looking into the range of possibilities concerning the origins of the supposedly new coronavirus. In early March of 2020 I published the results of my original survey in a 16,000 word essay that appeared in zerohedge, Infowars, UR, The Burning Platform, American Herald Tribune (now deplatformed by the FBI) and several other web sites.

    [MORE]

    https://www.unz.com/article/who-or-what-started-the-wuhan-coronavirus-epidemic/

    I included in my broad-ranging introductory overview a fairly detailed account of the Wuhan Military Games/US source theory, the thesis that lies at the core of the interpretations advanced with vehemence by Ron Unz and Kevin Barrett. I also included some commentary on the history of China’s biological warfare program. In commenting on my essay, Ron Unz dismissed the relevance of this subject altogether. Mr. Unz pointed specifically to a possible problem in a citation attributed by The Epoch Times to the analysis of General Chi Hoatian.

    I still see the theory of a US origin through the Wuhan Games as plausible, but there continue to be many other possible explanations for how the “Wuhan Coronavirus Epidemic” got up and running.

    The extremism displayed by Mr. Unz in responding to the “Wuhan Coronavirus Epidemic” essay has taken on larger meanings for me as I have witnessed over months and now years the increasingly strident and obsessive quality of his ongoing narrative on COVID-19. Mr. Unz insists again and again that China must be viewed as the victim of US aggression in biological warfare, a possible thesis but far from a proven one.

    Meanwhile the evidence keeps mounting that an important site of investigation must be the joint China-US banking networks cultivated into prominence by David Rockefeller when he was in his prime and largely preoccupied with transforming China into capitalism’s main industrial factory. Rockefeller’s success in that project forms a big part in the genesis of the dilemma in which the world is now mired.

    It is pretty clear to those that have looked into it, that in building up his Chinese operations Bill Gates took full advantage of the strategic turf opened up by the Rockefeller clan particularly in the medical field. Has Ron Unz looked into it? Gates stands out as a obvious facilitator in the process of bringing to life in the 2020s the Rockefeller’s Foundation’s Lockstep scenario introduced in 2010.

    I have not dismissed Christine Massey’s thesis that the so-called “COVID-19” strain of coronavirus has never been isolated and identified. This thesis did not occur to me when I was originally surveying the global bioweapons landscape in the winter of 2020. Moreover, I continue to ask questions about the SARs-related genetic sequence supposedly describing the “novel” coronavirus that was published on January 11 of 2020.

    This sequence was proclaimed to be of a fragment of the supposedly new coronavirus that has overturned the global health sector. Does this sequence truly correspond with the supposedly new coronavirus identified by the WHO as COVID 19? Where is the proof? What physical evidence, if any, was produced in January of 2020 to back up the claim that the published genetic sequence came from the cells of a genuine patient properly diagnosed as a victim of the new celebrity virus? What is the role of computer simulations in the genesis of the many frauds permeating the larger COVID deceptions?

    I do not dismiss the possibility that Jon Rappoport is onto something when this veteran investigator of the Duesberg/Fauci AIDS controversy treats the whole COVID-19 controversy as yet another scam exposing the pervasive rot infecting the whole science/pharma/media/government complex. As with many others, my original fascination with the possible origins in bioweapons labs of COVID-19 has given way to the understanding that the main biological weapons in this tragic premeditated emergency now underway are the gene modifying injections pretending to be vaccines. This drama of depopulation is playing out as it becomes increasingly clear that the injection weapons are also aimed at pushing AI operating systems beneath the human skin as Yuval Harari so openly explains on behalf of the WEF.

    • Agree: Mehen, allergic2katz
    • Thanks: geokat62, Mark Hunter
    • Replies: @allergic2katz
  386. @Mehen

    Rest assured, Unz and his lackey Kevin Barrett will ignore this evidence.

    • Replies: @Mehen
  387. Mehen says:
    @Allergic2katz

    I consider that possibility somewhere between “likely” and “more than likely.” Even worse though, is I expect him to continue to ignore the continuing stream of disconcerting and negative vax data pouring in. As I wrote here August 27th:

    https://www.unz.com/runz/challenging-americas-lords-of-illusion-with-a-million-contrary-rumble-views/#comment-5514720

    My last two relatively tame comments were dimmed by the mods with the [MORE] tag.

    The excess-mortality data from many countries keeps rolling in, Ron. It’s like a slow moving rising tide.

    I suggest you consider the implications if you still care about your future credibility.

    There is still time.

    Maybe.

    Ron had a chance to throw a last second shot, but I’m afraid the clock has run out…

  388. Antiwar7 says:
    @Antiwar7

    Sorry, meant to say: how it’s *all* wrong about the origins…

  389. @Wizard of Oz

    … the totally deranged idea that Americans (because the fighting forces were almost entirely American) killed a million Iraqis in about the first six months.

    So how many months did it take?

    Just curious – even honest Americans acknowledge the genocidal level slaughter that brought “freedom and democracy” to Iraq.

    AND the destruction of Iraqi lives and society has continued from that unilateral invasion two decades ago to the present day. Trash the country, kill mega-hordes of innocent civilians, pepper the landscape with depleted uranium and other undisclosed poisons, occupy the country with an installed totalitarian regime – what could possibly go wrong?

    BTW, this little excursion is SO off-topic – but you started it.

    In a token gesture to steer the discussion back to the parent article, one might observe that all the Empire’s minions rampaging illegally through Iraq based on a pack of lies, did so in lockstep – in much the same way as the entirety of the Western world now marches in lockstep to the tune of a bunch of genocidal psycopaths, again based on a pack of orchestrated lies enforced by mainstream media and big tech.

    • Replies: @Wizard of Oz
  390. @Wizard of Oz

    Would you like to say something about that and thus show you had some idea of the point I was clearly raising?

    Oh, you mean this?

    I would guess that the FDA may have noted that…

    Yes, indeed, the clarity of your comment is so blindingly enlightening I can almost hardly believe it…

    In any other circumstance, I might be tempted to say “God alone knows”, but in this case I seriously doubt it. To paraphrase Bruce Willis’ famous exclamation to Samuel Jackson –

    “Even GOD doesn’t know what point you’re making!”

    • Replies: @Wizard of Oz
  391. chris says:
    @CBB

    I have no reason to doubt what you’re saying, CBB.

    But, as noted, I haven’t listened to him lately either:

    Over the years, I had occasionally listened to Jones

    But a day or so after the ruling, I did listen to the first hour, and he definitely brought up the fact that Sachs had said that Covid came out of a bio lab and did not mention it to be a US one. If I find the time, I’ll add the citation and time on this thread.

    I wonder if Alex would actually interview Ron, or if Ron would do the Alex Jones show. I don’t see any reason why this shouldn’t happen.

  392. @Ron Unz

    Unlike you my use of language is not careless and I defy you to justify

    You’re an extremely gullible individual who just a few months ago was informing everyone that Putin was dying from cancer.

    My recollection is that I mentioned some of the rumours about Putin’s health as part of my contribution to trying to prevent you profound ignorance of Eastern European issues and history asking more of a fool of you than can be helped. (I haven’t heard/read recent speculations about Putin’s health or circumstantial accounts of the doctors attending him but it would still be information to consider if assessments were to be made accurately about future Kremlin decision making. That is undeniable is it not, if not very important?).

    I am sorry that I couldn’t help making the humiliating gibe about Ritter and Johnson and I fully understand your being upset rather than thanking me for providing you with seriously reliable punditry from Grneral Hodges. And I am sorry that my clerical skills do not match yours that I presume could have allowed you, if you chose to nominate a better thread on which to find a place to help you seem knowledgeable.

  393. @Wizard of Oz

    You never favoured the 2003 aggression, eh, Wizz. Did you speak out? Did you communicate your outrage to your myriad elite ‘friends’ and acquaintances? Or did you maintain a dignified and socially necessary silence, cultivating your moral vertue in private?
    As for the massacre, the Lancet study established the general parameters of the genocide, then the powers that be clamped down on information and the lying trolls of the MSM did their necessary duties. So we can add holocaust denier to your tawdry resume’.

  394. @g wiltek

    I was most intrigued to see that Ralph Baric did research on corona-viruses causing myocarditis and cardiomyopathy in rabbits some decades ago. I guess wabbits got too expensive to use, so further ‘research’ is being carried out on human ‘logs’, as they used to call them in Unit 731.

    • Replies: @Ultrafart the brave
  395. @Wizard of Oz

    Gawd, what entertainment. Google the Wizz’s latest idol, Corporal ‘odges, and you get a litany of dire predictions of Russian collapse, dating from early on in 2022. The latest, September 3, sang the praises of the famous Kherson counter-attack, utterly crushed by Russia with huge Ukrainian casualties. You don’t hear much about THAT anymore, do you? You live in a dream world, Wizz-time to retire your opium pipe methinks.

    • Troll: Wizard of Oz
  396. @Ultrafart the Brave

    Wrong. The OT issue of “1 million murders” was thrown up by MM.

    And you tell me what you think the relevant casualty figures were over the years, and from what sources you get them – if you can find a justification for pursuing it on this thread, or at all, given that MM is a blatant provocateur.

    • Replies: @Ultrafart the brave
  397. geokat62 says:

    Introductory paragraphs to A new report prepared for the Liberal Party of Canada shows that the vaccines have no benefit for those under 60
    Conclusion: “The Ontario data show that vaccination currently makes little difference in terms of hospitalization and death rates for those below age 60.”
    :

    A new report prepared by a group of highly qualified experts analyzed the government data in Ontario and concluded that the vaccines don’t reduce hospitalization and death in those under 60.

    In other words, we’ve been lied to. Are you surprised?

    Also, don’t assume the report endorses vaccination for those over 60. It doesn’t.

    https://stevekirsch.substack.com/p/a-new-report-prepared-for-liberal

  398. Bert says:
    @Levtraro

    Your comment is the equivalent of a drive-by shooting.

    First, you seem not to realize that peer-review and publication in high-impact journals are no longer imprimaturs of veracity. For any question about SARS-2 or Covid-19, the opposite is more likely to be true. See https://pierrekory.substack.com/p/the-criminal-censorship-of-ivermectins?utm_source=substack&utm_medium=email

    Second, “binomial” was not misspelled in the Abstract. It appeared twice there, once spelled correctly and once with a single additional letter that was clearly a typo.

    Third, you implied but did not explain why another distribution rather than the binomial should have been used.

    Fourth, implicitly you seem to have no problem with The Man’s explanation of the sudden appearance of such a highly divergent strain as Omicron, i.e., that it evolved in an immuno-compromised person. The flaw in that hypothesis is that there are millions of such people, yet only one appearance of a strain with Omicron’s characteristics.

    • Replies: @Levtraro
  399. geokat62 says:

    Telegram comment posted by Dr Mike Yeadon:

    I strongly recommend everyone take the few minutes to watch this & then go and politely bother a few people with it.
    How else is this ever to end?
    The mass media isn’t going to tell them & I cannot.
    So for each of your networks, it falls to you! There is no alternative!
    Thank you,
    Mike

    Mike.

    Absolutely incredible data and evidence from Dr Scot Youngblood in San Diego, 13th of September 2022. 12 minutes and brilliantly produced.

    https://t.me/robinmg/23255

    • Thanks: Ultrafart the brave
  400. @Ron Unz

    Oops! I was so keen to avoid further embarrassment to the poor boy that I neglected the obvious…..

    JUST TAKE 2 SECONDS TO GOOGLE “PUTIN’S HEALTH”. There’s lots of recent stuff. What should be made of it? It even includes predictions that Putin won’t be able to carry on much longer as leader. Presumably, if he were to step down, he would not facilitate takeover by the rabid genocidal nationalists who are now criticising the conduct of the war.

  401. @mulga mumblebrain

    I guess wabbits got too expensive to use…

    It was wabbit season back then.

    Now it’s duck season.

    Incidentally, I just had the opportunity to watch the last Bond movie – vewwy vewwy intewesting.

    As I’ve heard repeatedly over the last many years – the movie is the message.

  402. @Ron Unz

    Another trollish aspect of this website of late, Mr. Unz, is your fake finger wagging and solicitous engagement with this person’s disruptive dissembling, which seems to leave insufficient time for those here in good faith. (I have repeatedly posted how Wizard was caught engaging in sock puppetry.) Those who return to these threads hoping to learn something frequently have to scroll through reams of this garbage. No one here — you included — thinks he’s “an extremely gullible individual.”

    If you keep up this bad behavior, your comments may get trashed.

    Not a chance. He’s part of the show.

    • Agree: Rumpelstiltskin
    • Replies: @Wizard of Oz
  403. @Wizard of Oz

    Wiz, Wiz, Wiz – you’re such a stirrer!

    Now you’re going to get us all in trouble by leading us merrily away in an off-topic direction.

    JUST TAKE 2 SECONDS TO GOOGLE “PUTIN’S HEALTH”. There’s lots of recent stuff.

    Sure there is.

    Never mind that Google is owned by Alphabet which is owned and controlled by frigging Globalists.

    What should be made of it?

    By default and as a cautionary principle – total BS unless multiple independent reliable sources can corroborate – and beware the echo chamber effect.

    Presumably, if he were to step down, he would not facilitate takeover by the rabid genocidal nationalists who are now criticising the conduct of the war.

    Martin Armstrong says that if Putin is removed, he will replaced by hardliners – an eventuality which, given the psychos controlling the West who have no reverse gear, will rapidly engulf the world in all-out war.

    Martin Armstrong relies on Socrates for his assessments – and Socrates has never been wrong.

    The most tenuous possible connection of any of this with the parent article is that those naughty American bioweapons labs in Ukraine – a core focus of the Russian SMO – were allegedly involved in the genesis of the alleged Corona Chan bug (and much much more besides). Including Australian laboratories paying for delivery of blood samples from those same American bioweapons labs operating in Ukraine.

    Yet hardly a peep from any media – mainstream or alternative – on any of that.

  404. @Wizard of Oz

    Wrong. The OT issue of “1 million murders” was thrown up by MM.

    Perhaps your cultural upbringing hinges on an esoteric train of logic that conjures connections from out of the aether. I have an open mind – all of us have an innate mystical faculties, after all.

    However, it would aid the precision of this off-topic intercourse to understand how your statement relates to anything that was said in the prior post. I find it all very vague and nebulous, tangential at best.

    At some level, I get the impression that you’re ducking and weaving – attempting to hide the ship’s hawser behind a piece of string. Jesus Himself warned us against such hypocrisy. Shame on you.

    … if you can find a justification for pursuing it on this thread, or at all…

    To be frank, none of us is justified in pursuing this off-topic thread – mainly because it’s off-topic – but again, may I remind you, you started it.

    I honestly cannot fathom where Mr. Unz gets the patience…

  405. @Rumpelstiltskin

    Unfortunately, it seems Unz is NOT staying away from censorship.

    He claims ,”I don’t want this comment-thread cluttered up with anti-vaxxing nonsense,” but allows no end of off-topic clutter. Yet he will not allow certain posts that are directly relevant to the question of who/what is behind Covid. As far as I can tell there are certain highly impactful graphics that he will not allow, though he will allow links to articles that convey the same message. This makes sense in light of his view that ‘people don’t like to read’. A trickle of truth is okay; viral truth is not.

    I think that tips the balance into potential criminal liability as a propagandist when and if tribunals ever occur.

    • Replies: @Rumpelstiltskin
  406. @Tony Hall

    Mr. Unz’s article wasn’t worthy of such a well-argued reply, but here it is anyway.

    Thank you for posting this. Hopefully Mr. Unz will consider publishing it as a standalone post.

    • Replies: @Tony Hall
  407. Really outstanding experts, at least like Jeffrey Sachs, who warn against mRNA injections because the risk-benefit ratio is far too bad (ineffective, unacceptably high health risk):
    Peter McCullough, Paul E. Marik, Christian Perronne, Sucharit Bhakdi, Stephan Hockertz, Luc Montagnier (and much more).
    All these people are at the forefront of medical science. Christian Perronne has shaped health policy in France for 14 years like no one else. He is partly responsible for the French vaccination plan.
    All these people were not vaccination opponents before.

    I had the opportunity to talk to a biologist who worked on the mRNA vaccination technology. In normal times, the vaccinations would not even have received approval from the ethics committee for human studies, because too many aspects (distribution, behaviour in the body, etc.) were not known. Exactly what toxicologist Hockertz criticised early on: insufficient safety data.

    Now, it is not an exaggeration to say that vaccinations and especially vaccination policy have led to millions of unnecessary victims, as there were better treatment options than vaccinations as of March 2020.

  408. As a medical doctor, after the damage has been done, we are interested in how best to protect and treat people. And just as the development and spread of the virus was a crime, it was at least as big a crime to suppress effective therapies against the disease. This in the service of the madness of vaccinating 7 billion people. Christian Perronne and Peter McCullough spoke of how up to 90% of covid deaths could have been prevented.
    If that is not a crime against humanity?

    • Replies: @mulga mumblebrain
  409. @Ultrafart the brave

    It is a weakness that I spend any reading time on MM’s rants and very occasional more or less unadorned statements of fact. So I try to keep my responses brief. A bit like this one.

  410. @C19treatingphyician

    A HUGE crime, but simply business as usual for the Western Herrenvolk, a myriad of pustules of Evil. Just what the crime really is, we won’t know for a while.

  411. @Ultrafart the brave

    Wizz’s ‘cultural upbringing’ as one of Austfailia’s fifth-rate ‘elites’ taught him that the deaths of ‘wogs’ abroad are of NO consequence. Denial is simply the public stance-with friends from among ruling circles the reaction would, I believe, be satisfaction at terminating numerous ‘useless eaters’.

  412. @Wizard of Oz

    Anyone who saw Putin answering questions yesterday could see that he is an healthy 69 year old. The Google entries are invariably Western black propaganda lies, as any fool can see, but you’re not any ordinary fool, are you Wizz.

  413. Tony Hall says:
    @allergic2katz

    Thanks allergic2katz. Since Mr. Unz introduced anti-vaxx crackpottery before his initial cancellation of Mike Whitney’s regular post, UR has been somewhat sidelined as a credible free speech by dropping the ball on such a vital subject where the need for open unfettered debate is so crucial. I have watched this process unfold since I first jumped into the COVID discussion in early 2020. I thought I would make a bid to open the conversation by adding background and context.

    I have continued to publish on the manufactured COVID crisis at Global Research.ca. Here’s something very recent.

    https://www.globalresearch.ca/covid-19-power-grab-organized-crime-2/5793438

    • Thanks: allergic2katz
  414. @mulga mumblebrain

    I can’t help it. One of you keeps on amising me with such bare faced absurdities as your pretence that you can tell what the state of a person’s health is from a staged video half way round the world!

    I’m surprised that you didn’t pick up the CIA’s Burns joking that Putin was unfortunately well. Maybe you worried that he was trying to make sure Russia didn’t suspect how well the CIA really is.

  415. @Ron Unz

    I will try harder if you can explain how this is really OT

    How history caught up with my Russian academic friends – https://on.ft.com/3qJw9i6 via @FT

    Is it because it is in the FT where I have listened to it? In other words because it is not in or directly about alternative media.

    It is rather depressing is it not?

  416. @Greta Handel

    So you don’t trust Ron? A pity though it is only in the last year that I have had to say some of his stuff about my past Comments is dishonest misrepresentation.

    Perhaps we can clear up your boring little “sock puppet” story by asking him to confirm, as he clearly can, that there is no evidence for at least three years of my having a sock puppet. I suppose I might find ways to outwit his software – though it present it would be doing a pretty good job of messing with my mind if I cared – but I rely can’t be bothered to use a sock puppet to allow me to respond to someone whom it is undignified even to acknowledge reading. That, after all, includes at least 80% of Comments.

    • Replies: @mulga mumblebrain
  417. @Rumpelstiltskin

    To be clear,

    Not everyone’s called to be a hero, and Unz is getting more good Covid info out there than I am, by hosting a platform. There are heroes in this mess, though, including plenty of Jews. Meryl Nass, Pierre Kory, Zev Zelenko (even tho he was in the talmud cult), Jessica Rose, Steve Kirsch, Simone Gold, Henry Makow, Brother Nathanael, and I’m sure many more.

    But I can understand and accept that Unz doesn’t want to host a nexus of rebellion against the NWO. Maybe he figures he’s just keeping the stereo low enough so the cops don’t come bust the party. And maybe that’s right.

    But making claims, arguments and innuendo; hammering away at them repetitively; declining to address evidence and arguments to the contrary; and then hobbling the response… well, it isn’t quite cricket, now is it. As Unz has stated, this is one of the greatest crimes in history (and even so he’s greatly understating it). Wouldn’t it be better to avoid the topic if it’s too hot, rather than taunt a bunch of people who consider that a crime is being committed against them? Ah, but I think Greta’s got it right.

    Oh, the things censored. A diagram of the bilderberg group and its connections to hundreds of corporations. You can find it at wednesday’s (9/14) snippits and snappits (a superb site). The other was a visual of key Jews in the Biden Admin and in the Covid fraud, over at Henry Makow’s site a while back. I’m sure it will crop up again.

    Does anyone else think it is odd how much attention Jews get in the articles (and commentary) on this site, but how little there is about freemasons and related groups?

  418. A123 says: • Website

    Despite the best effort of Manda-vaxxer extremism: (1)

    28 percent have not received any coronavirus jab from any manufacturer, compared to 72 percent who said they have. What is more, 58 percent indicated that they are at least triple vaccinated.

    those who are unvaccinated will remain so, as 66 percent said they do to plan on getting any shots, followed by 16 percent who said they “might” and nine percent who said they will in the future.

    The survey was taken September 10-13, 2022, among 1,500 U.S. citizens

    The populations of both jabbed versus unjabbed are large. Over time, with careful monitoring, the relative health of the two groups should be unambiguous.

    As there is no way to “unjab” people, is it not wise on focusing on the potential future abuses by unhinged Manda-vaxxers?

    PEACE 😇
    __________

    (1) https://www.breitbart.com/politics/2022/09/17/three-in-ten-americans-still-refusing-to-get-the-coronavirus-jab/

    • Troll: mulga mumblebrain
    • Replies: @Ultrafart the Brave
  419. @Ron Unz

    Do you identify yourself in the self-hating Hindu?

  420. For Mr. Unz, here’s a development that might be of some interest in relation to your perception of the alleged “anti-vaxxer” community.

    Not everyone opposed to the Corona Chan “vaccines” is riding the same horse, and not all are even primarily concerned with the alleged Corona Chan bug or the fake “vaccines”.



    Video Link

    Note in particular here that Dr. Fuellmich, after championing extensive interviews with over 400 subject matter experts from around the world with the Coronavirus Investigative Committee (which has fractured apparently due to internal disagreements), is now moving to expand the scope of his efforts by creating and running a new “International Crimes Investigative Committee” (ICIC) – to capture all of the criminal aspects of the Globalists’ efforts to implement their Great Reset (ref 00:02:17 in the video).

    Although somewhat long-winded, the point here is that Corona Chan is just one front, arguably the opening campaign, in an orchestrated global attack to wrest total control of humanity and the entire planet into the hands of a tiny unelected cabal (call them what you like – I personally characterise them as Satanic psycopaths).

    We are seeing all of this unfolding in the chaotically managed collapse of the social and economic strata of so-called Western civilisation. This necessary destruction underpins the Globalist mantra of “Build Back Better” – a literal prerequisite for their New World Order.

    Martin Armstrong has been warning for some time now that much more mayhem is coming down the pipes, and Socrates forecasts that it won’t be over until sometime around 2032.

    Long before then, the origin of the Corona Chan “pandemic” might be acknowledged as the start of all this lunacy, but I’d wager that it will be the least of our worries.

  421. @A123

    Over time, with careful monitoring, the relative health of the two groups should be unambiguous.

    The matter is already crystal clear for many of us.

    Ambulances are running 24/7 here in Melbourne. Not an hour goes by when I can’t hear one or two of them screaming up and down the highway near where I live.

    I very recently had to catch a young checkout chick as she literally passed out and collapsed onto the floor in a major supermarket chain. Other supermarket workers then came along and carried her out the back. I have no clue what happened to her after that.

    All the major Australian supermarket chains sacked all of their uninjected employees. There are no “unvaxxed” workers in major Australian supermarket chains – they’ve all been injected.

    • Replies: @Wizard of Oz
    , @A123
  422. @Thomm

    What is the true purpose of this website and when did Ron Unz describe White nationalist commenters as his lab rats?

  423. @Wizard of Oz

    Ha, ha, ho, ho-if given the choice between Unz and you, Wizz, as to who is representing your often garbled disinfo blatherings more correctly, Unz is ‘London to a brick on’, as they used to say in racing circles. I’ll cut you some slack, however-you probably don’t recall what you said yourself with any exactitude. Sic transit gloria mundane.

    • Replies: @Wizard of Oz
  424. @Ron Unz

    Unless our intelligence agencies have pioneered the technology of precognition, I think this may have happened for the same reason that arsonists have the earliest knowledge of future fires.

    This is clearly a powerful argument, but it compels us to examine what was going on before publication of the DIA memo.

    The Chinese defector Wei Jingsheng claims that he learned about COVID from his contacts in China, and informed the US authorities, even including a senior US politician – in October 2019. He believes that the World Military Games were the first superspreader event, and the propagation of the virus at the games may have been a deliberate act of the Chinese authorities.

    https://www.nzherald.co.nz/world/covid-19-coronavirus-chinese-defector-wei-jingsheng-claims-he-warned-us-of-covid-months-before-pandemic-declared/KS7WNS3RLQEOB2IZTFHY5DTEOM/

    https://www.nzherald.co.nz/world/covid-19-coronavirus-allegations-of-first-superspreader-event-occurred-at-wuhan-military-games-in-october-2019/45ILL7HBJGKJ5WYC4SFUZWZEFA/

    I doubt his opinion of the Games, because if it were true then COVID would have spread around the world much sooner than it did.

    The articles refer to a Sky News documentary, “What Really Happened in Wuhan”, and a book of the same name by Sharri Markson.

    The Republican House Minority Foreign Affairs Committee, led by Rep. Michael T. McCaul, released an addendum to their earlier report on the origins of COVID. On p63 they give a timeline of events, most of which are familiar:

    2018: As discussed in our original report released last year, in 2018 U.S. State Department officials sent cables to Washington, D.C. highlighting concerns with safety issues at the WIV. The cables reported that scientists at the WIV noted “a serious shortage of appropriately trained technicians and investigators needed to safely operate this high-containment laboratory.” The cables also questioned the PRC’s commitment to prioritizing the important research for which the lab was designed. (p18, not included in the report’s timeline)

    May 15, 2019: Yuan Zhiming, the Director of the BSL-4 lab at the WNBL, submits a frank article to the Journal of Biosafety and Biosecurity, entitled “Current status and future challenges of high-level biosafety laboratories in China” (p18-19, not included in the report’s timeline)

    July 16, 2019: The WIV publishes a tender requesting bids to conduct renovation on the hazardous waste treatment system at the Wuhan National Biosafety Lab (WNBL). The closing date was July 31st.

    Late August/Early September 2019: One or more researchers become accident[al]ly infected with SARS-CoV-2, which was either collected in the Yunnan cave, or the result of gain-of-function research at the WIV. They travel by metro in central Wuhan, spreading the virus.

    This is guesswork by the committee (p26).

    September 12, 2019: At 12:00am local time, the Wuhan University issues a statement announcing lab inspections. Between 2:00am and 3:00am, the WIV’s viral sequence and sample database is taken offline. At 7:09pm, the WIV publishes a tender requesting bids to provide security services at the WNBL.

    The summary is misleading – the database was not offline for an hour, as would typically happen for software maintenance – it was permanently taken offline at some time between 2am and 3am.

    September – October 2019: Car traffic at hospitals surrounding the WIV Headquarters, as well as the shuttle stop for the WNBL, show a stead[y] increase before hitting its highest levels in 2.5 years. Baidu search terms for COVID-19 related symptoms increase in a corresponding manner.

    See figure on p25. There was a steady increase in parking lot usage, as seen on satellite photos, in September and October, followed by a sharp decrease in November. The spike in Baidu searches began in late November, with a bigger spike in early 2020 when COVID was announced.

    Late October – Early November 2019: The international athletes return home, carrying SARS-CoV-2 around the world.

    Again, guesswork by the committee.

    https://gop-foreignaffairs.house.gov/wp-content/uploads/2021/08/ORIGINS-OF-COVID-19-REPORT.pdf

    Overall, it was well known not only in China but in the USA that the safety practices at WIV were inadequate. The combination of apparently routine events on September 12th 2019 may be coincidental, but may also signal that WIV realized that something had gone wrong. Hospital parking increased gradually in September and October to the highest levels seen for 2.5 years. In late November something happened, presumably the realization that Wuhan had an epidemic – at this point, hospital parking sharply decreased, and Baidu searches for “cough” began a steep increase.

    The key question for the “arsonist” view is – did anything happen between September 2019 and the November memo from the DIA? The answer seems to be “yes”, but we do not know exactly what. One could speculate that the events of September 12th were a reaction to some kind of security incident involving virus containment at WIV; while the events of November 2019 were the recognition that Wuhan had an epidemic.

    Is it possible that the DIA memo was a reaction to the outbreak in November 2019, and that the US authorities, having been forewarned by Wei Jingsheng, were already on the lookout for an epidemic in Wuhan? The DIA would be extremely embarrassed that they had not spread their warning more widely. Both the US and Chinese authorities could have begun taking precautions months earlier than they did, and they might even have had the chance to contain COVID before it became a pandemic.

  425. @Ultrafart the Brave

    I had been triple vaxxed but still caught Covid mildly (presumably omicron a few months ago. And I had, through insouciance, about day 6, the experience of having to lie down in a bus shelter after walking to my local chemist 10 minutes from home in Melbourne. When I resumed walking home I was seen to be in such a condition by a couple of pleasant young men that they called paramedics and I ended up being taken to the nearest emergency department by ambulance. Three days later I went home after my treating doctor lowered my BP medication which, rather eccentrically, my new young cardiologist had put up after initially cutting it down. (When I was staggering before being taken by ambulance it was amazing that I could stand, just, and talk, because my BP was 65/30!)
    30). RATs said I undoubtedly had Covid and I knew from whom I caught it at a conference dinner as his father rang me the next day to say that he had caught it too.

    So…. does that leave you so sure that the employee you observed must have had a vax caused illness. Or does your anecdote add up to that UR specially, a nothingburger?

  426. @mulga mumblebrain

    In case you haven’t noticed it is easily testable from the record of my and Ron’s comments so why don’t you try to prove that you aren’t the psychotic blatherer you portray yourself as by proving your point? You can’t of course because your judgment is wrong.

  427. @James N. Kennett

    Ron will undoubtedly have ready answers, if not convincing ones,
    to your points, probably starting with an accusation that you have failed to read and remember his previous posts. Unfortunately it is unlikely to make him accept the unwisdom of leaping in with an early special insight that needs, to justify even half his stubborn certainty, that he have far more information and have considered many different angles proferred from others’ insights.. no brainstorming sessions for Ron unfortunately.

  428. geokat62 says:

    Explosive excerpt from Dr. Mike Yeadon’s The Most Important Single Message I Have Ever Written:

    If you experimentally adopt the position that OUR GOVERNMENT IS ACTIVELY WORKING TO HARM US, TO DISMANTLE MODERN SOCIETY & ENSLAVE ALL PEOPLE IN A DIGITALLY CONTROLED TOTALITARIAN WORLD, it all fits. Nothing is surplus.

    [MORE]

    https://jamesroguski.substack.com/p/what-is-the-government-of-the-united

    Dear everyone who is nervously looking around and is asking “What the hell is going on?”,

    I hope this isn’t too controversial. It’s certainly frightening, but I believe we are still the right side of disaster & if enough of us become aware of what is happening here & everywhere in the democratic world, we can recover the situation. We really don’t have long. I believe it’s likely things will change irretrievably over this coming winter. Hence this urgent & unusual request.

    Everything that’s happened & is happening becomes much simpler & it all makes sense, only when you force yourself to think the impossible.

    If you experimentally adopt the position that OUR GOVERNMENT IS ACTIVELY WORKING TO HARM US, TO DISMANTLE MODERN SOCIETY & ENSLAVE ALL PEOPLE IN A DIGITALLY CONTROLED TOTALITARIAN WORLD, it all fits. Nothing is surplus.

    Even if your immediate response is that this is absurd, please try it for a day or so.
    I ask you further to adopt the experimental position that the media, controlled by just six global corporations, all allied to a single global organisation you’ve all heard of, is relentlessly lying to you & has been doing so for over 2.5 years. Same for the internet, controlled by fewer global corporations, also all allied to that same global organization.

    Because I am certain it’s true. I am certain because this all started with a scientific fraud relating to a virus, augmented it with a relentless campaign of fear, imposed measures known to be useless, which wrecked the economy & smashed civil society, then coerced most to accept useless, unnecessary, ineffective & deliberately dangerous injections.

    Obviously this is an odious crime. Nothing like it has ever happened.

    I’ve been 41 years in life sciences from training to successful biotech CEO & was worldwide research head & Vice President of Pfizer’s respiratory unit (1995-2011).
    I have absolutely no incentive to say any of this if I wasn’t certain.

    I am certain. This all took place “in my wheelhouse”, my domain of expertise.
    Please consider that I’ve said.

    I’ve given over 70 interviews, all censored. I’ve been foully smeared. It’s propaganda. It tells you what they’re capable of.

    Here’s what Pfizer’s former board member wrote about my a accomplishments.
    Do I sound like a fool?

    Many have asked why people didn’t resist tyrants in the past. Partly it is fear. But it’s more than that. It’s that normal people, like you & me, simply cannot imagine being so evil. We trust in humanity. And so we should. Most people are good. Few are truly terrifyingly horrible. But some are. It’s the inability to believe it’s happening that really stopped people objecting when they should, when the evidence was unmistakable but had not yet quite reached their door, their family. They are coming for you & your children. It is happening again. There’s ample evidence emerging of long term, patient planning.

    I’m so sorry.

    It’s now up to you. I genuinely don’t see what else I can do.

    Best wishes & sincere thanks,

    Dr Mike Yeadon

    https://mark-skidmore.com/2022/08/31/dr-mike-yeadon-the-most-important-single-message-i-have-ever-written/

    • Thanks: Ultrafart the Brave
  429. A123 says: • Website
    @Ultrafart the Brave

    Over time, with careful monitoring, the relative health of the two groups should be unambiguous.

    The matter is already crystal clear for many of us.

    Ambulances are running 24/7 here in Melbourne. Not an hour goes by when I can’t hear one or two of them screaming up and down the highway near where I live.

    Australia and Israel are virtually 100% vaxxed. The U.S. is only 70% vaxxed.

    It would be interesting to see the hospitalization and mortality rates in a cross tab form where similar age and ethnic groups compared to we if there is an unexpected 10:7 ratio, especially among younger parallel demographics.

    Information specific to myocardia and unusual blood clots would be very useful as physical indications in a cross tab analysis.

    PEACE 😇

    • Replies: @Ultrafart the Brave
  430. geokat62 says:

    Must see interview!

    Former Pfizer VP, Dr Michael Yeadon, drops the gauntlet on four individuals for their role in the fiasco that was the Covid plandemic… his former colleague Patrick Vallance (one of UK gov’ts chief Covid advisors), and three of his former colleagues that were in the research departments of various pharmaceutical companies: Mene Pangalos (AstraZeneca), Mathai Mammen (Johnson & Johnson), James Merson (Pfizer).

    22 – On Building Back Netter, First by Destroying

    https://odysee.com/@MaajidNawaz:d/EP22-Radical:1

    The fun begins at the ~50 min mark.

  431. Ron Unz says:
    @James N. Kennett

    The Chinese defector Wei Jingsheng claims that he learned about COVID from his contacts in China, and informed the US authorities, even including a senior US politician – in October 2019.

    Sure, the Wei Jingsheng defector story is at the heart of Sharri Markson’s book, which I had carefully read and reviewed late last year:

    https://www.unz.com/runz/american-pravda-confronting-covid-crimestop/

    But frankly it seemed like total garbage to me, up there with the Saddam WMD hoax.

    For example, are you aware that Wei and his friends all claimed that Covid was a secret bioweapon that had been deliberately released in Wuhan probably due to an internal PRC power-struggle?! That seems like utter and complete lunacy to me, annihilating his credibility. Indeed, the theory was so preposterous that even all of Markson’s fiercely anti-Chinese American intelligence sources like Pompeo rejected it as totally ridiculous. So if you bring in Wei as part of your argument, you carry along a huge quantity of baggage.

    Anyway, the secret DIA report claimed that their knowledge of the potentially “cataclysmic” disease outbreak in Wuhan came from electronic intelligence such as satellite info rather than a defector like Wei. There’s absolutely ZERO evidence that there was any macroscopically visible disease epidemic in Wuhan in early November.

    See figure on p25. There was a steady increase in parking lot usage, as seen on satellite photos, in September and October, followed by a sharp decrease in November. The spike in Baidu searches began in late November, with a bigger spike in early 2020 when COVID was announced…Hospital parking increased gradually in September and October to the highest levels seen for 2.5 years.

    No that nonsense about satellite imagery was very likely concocted after the Israelis confirmed the existence of the secret DIA report, demonstrating American foreknowledge of the outbreak and putting the US into a very difficult situation. I analyzed it at length in a section of one of my articles:

    https://www.unz.com/runz/american-pravda-the-covid-epidemic-as-lab-leak-or-biowarfare/#trying-to-disguise-a-smoking-gun

    You’re not thinking logically. Covid is ultra-contagious and cases grow exponentially without strong public health measures, increasing between 100x and 1000x per month.

    Wuhan is a city of 11 million and if all the local hospitals were already overwhelmed with Covid patients in September or October 2019, there must have been tens of thousands of infections, leading to millions of infections by the end of the year. But that wasn’t the case.

    Anyway, the highly authoritative Pekar study now indicates that Patient Zero in Wuhan was probably infected around November 18th plus or minus a couple of weeks or so. That completely discredits all that fabricated nonsense by Republican sources about clogged hospitals back in September.

    Regarding safety conditions at the Wuhan lab, you’re relying upon supposed American intelligence claims, very likely coming from the individuals who are the most likely suspects in the biowarfare attack on China. Instead, the single most credible Western eyewitness was experienced Australian virologist Danielle Anderson who was working at the Wuhan lab during the period in question and in her Bloomberg interview, she described the safety conditions as absolutely outstanding, better than at her own lab. She also was very skeptical that any lab-leak had occurred or that Covid was developed at the WIV.

    There’s absolutely ZERO evidence of a lab-leak at Wuhan or even poor safety conditions. Are you even aware that during the summer of 2019 our own main biowarfare facility at Ft. Detrick was ordered shut down for several months because of major safety violations? That why all the pro-China propaganda-activists always claim that Covid leaked out of Ft. Detrick. That’s nonsense, but there’s still vastly more evidence of major safety violations at our top biowarfare lab than at the WIV.

    Anyway, none of the “chaff” you’re regurgitating from totally biased American sources addresses the other major issues:

    (1) Almost immediately after the Wuhan outbreak, the Covid virus suddenly hit the Iranian political elites in the Holy City of Qom that has absolutely minimal connection with China or Chinese. This occurred just a few weeks after America had assassinated Iran’s top military leader. Pure coincidence?

    (2) Robert Kadlec, America’s top biowarfare advocate, began his federal/state Crimson Contagion exercise in January 2019 which ran until August. The exercise was intended to prepare America for defense against leakage of a dangerous Covid-like virus if it happened to appear in China. A few weeks after the end of the eight month exercise, Covid appeared in Wuhan. Yet another coincidence? And how does January 2019 fit into your own proposed timeline.

    Are you even aware that several of the key individuals involved in blaming Covid on a Wuhan lab-leak are the same people heavily involved in the Iraqi WMD hoax?

    Based upon the issues you raise, it sounds like you haven’t bothered reading any of my articles or perhaps even watching my interviews. Instead, you’ve been relying upon the Iraqi WMD-type garbage produced by Pompeo and his Republican allies. Before I waste any more time on your arguments, I strongly suggest you read and digest several of my articles:

    https://www.unz.com/runz/american-pravda-the-covid-epidemic-as-lab-leak-or-biowarfare/

    https://www.unz.com/runz/american-pravda-confronting-covid-crimestop/

    https://www.unz.com/runz/american-pravda-waging-biological-warfare/

  432. @Wizard of Oz

    Please tell me you had Pfizer or Moderna, Wizz-you deserve the mRNA treatment, and I’m sure you’ll be delighted to contribute to BigPharma’s mega-profits by being a semi-human lab rat. And only triple vaxxed-you must try harder!

    • Replies: @Wizard of Oz
  433. @James N. Kennett

    Chomsky once observed that defectives…sorry…defectors are the least trustworthy sources of information re. the countries that they left. Wei, of course, is a traitor compradore, from the time of the failed Colour Revolution in 1989, an enemy of his country and civilization, and undoubtedly on the US Deep State payroll. Who better to conjure up laughable propaganda shite, and who better to peddle it than the ultra-odious Murdochite Sharri Markson, of whom, I would say, nothing pleasant or positive may be said.

  434. @Ron Unz

    Of course you remind readers of some interesting coincidences but what have you done to firm up your case for the “smoking gun” report actually existing? I don’t think you have ever mentioned FOIA. And you are still relying on one Bloomberg interview of Danielle Andersom. Have you sought more witnesses? Have you written to her and have you heard back?

  435. @mulga mumblebrain

    Astra Zeneca twice followed by Pfizer and Moderna and I don’t think it has cost me anything. Unfortunately I have no Big Pharma shares.

    • Replies: @mulga mumblebrain
  436. @A123

    Australia and Israel are virtually 100% vaxxed.

    Can’t speak for Israel, but word on the street is that Australia’s true injection rate is maybe somewhere around 60% or even less.

    Official statistics are tailored to a narrative – one can speculate why they do this, one possibility is to persuade the uninjected that they are a small minority and all alone in their resistance, another is that the f*cking psychos at the top have a quota to meet and need to placate their Globalist masters, or any combination of these factors combined with whatever else motivates the government and media stooges.

    The irony is that – if the injection rate is actually that much lower than officials claim – then it makes the tsunami of adverse events even worse in relative terms.

    The U.S. is only 70% vaxxed.

    TBH, I suspect that the USA injection stats might be way overstated, just as in Australia, and for similar reasons.

  437. @Wizard of Oz

    So…. does that leave you so sure that the employee you observed must have had a vax caused illness.

    As anyone reading my prior comment can see, I made no claim as to what it was that afflicted the poor girl. Short of a detailed pathology report, all that common folk on the street have is circumstantial evidence.

    [MORE]

    I for one prefer not to become another circumstance.

    As to your experience, were I you, I wouldn’t be getting too comfortable. Strange that your brush with fate so closely followed your injection. I hope you understand that the so-called RAT detects the very same elements which are injected into your blood by the “vaccines”? This is even worse than the fakery of the PCR tests which have been publicly disavowed by the American CDC.

    If you manage to survive, then that’s a good thing. I have several siblings who have grudgingly lined up for their injections, including the so-called “boosters”, in order to keep their employment. Knowing now that the injections typically take 5 months or longer to kill their recipients, with structures slowly growing inside veins and arteries eventually cutting off blood flow to vital organs, it’s now just a waiting game to see who is lucky and who is not.

    The newly labeled “SADS” syndrome, which correlates perfectly with the known progression of injection adversities, constitutes implicit recognition of those consequences while paradoxically and meticulously denying its cause.

    By your own description, you have heart problems – best to be wary of conflating causes. While funeral directors like John O’Looney have been pulling white rubbery structures out of a growing number of injected dead since the injections commenced, just lately the same structures have been pulled out of living injected patients too – very very fortunate for them.

    • Replies: @Wizard of Oz
  438. @Ultrafart the Brave

    There’s not much point in worrying though I am glad to one that my blood relations under 65 including many athletic ones under 24 are thriving despite the vaccinations that I had suggested they postpone as a precaution.

    I am reminded of the prevalence of Repetition Strain Injury in the 1980s. Real or psychological fashion? Some of what you nention is, anecdotally, evidence of something physical.

    • Replies: @mulga mumblebrain
  439. @mulga mumblebrain

    You do ‘t really deserve to be better informed and better prepared to face reality when everything turns out disastrously from your team’s point of view, but this, from publication and author who will make the reading bracing for you, allows me to ask whether you disagree with the author and, if so, why.

    https://www.atlanticcouncil.org/blogs/ukrainealert/putins-russian-empire-is-collapsing-like-its-soviet-predecessor/

    • Replies: @mulga mumblebrain
  440. Levtraro says:
    @Bert

    First, yes peer review is fundamental to science and will continue to be so.

    Second, OK, spelling error omitted from further consideration.

    Third, the binomial distribution for each mutation assumes that mutations are independent of each other. That is a crazy assumption given the virus evolves inside biological systems that exert selective pressures. Authors recognize this inmense shortcoming when they say “sorry we assumed no natural selection”. Assuming independence of mutations is a deal breaker, the manuscript will be rejected as “premature”. But I am not going to give you the correct model for the probability of mutation of the COVID-19 virus into the omicron variant in this comment.

    Fourth, no, I don’t assume the natural origin of the latest variant. I don’t assume anything in this issue because it might well be that the omicron variant, as well as the original virus itself, are artificial concoctions. It’s just that the manuscript you quote does not make the case well, authors have produced a work that is “premature” (“premature” is the word preferred by editors when rejecting a manuscript with obvious errors, lol!).

  441. g wiltek says:

    We have never heard what happened to Tiffany Dover?, the nurse who fainted after the shot on open TV. Is that not strange?’
    The media is quite capable of setting the narrative, as most is controlled by about a handful of people.
    And some people still cannot imagine collusion and conspiracy.
    Strange indeed.

  442. g wiltek says:

    And let me then finish with this video, collection of adverse events. Only for people with strong nerves.
    https://www.lewrockwell.com/2022/08/joseph-mercola/testimonies-from-covid-jab-injured/

  443. geokat62 says:

    Telegram comment posted by Dr Roger Hodkinson:

    [MORE]

    Dr. Jessica Rose: The Risk/Benefit Analysis for These Shots is So Simple

    The Risks:

    • Death

    • Increased susceptibility to contracting and dying from COVID with each subsequent shot

    • Increased chance of having a spontaneous abortion

    • Countless other issues

    The Benefits: …

    “Nobody needs these shots, in my opinion.”

    Join 👉 https://t.me/RogerHodkinson

    https://t.me/RogerHodkinson/564

    • Agree: g wiltek
  444. @Ron Unz

    Based upon the issues you raise, it sounds like you haven’t bothered reading any of my articles or perhaps even watching my interviews.

    I have read most of the articles, some of them more than once, but my memory is not as good as yours!

    There’s absolutely ZERO evidence of a lab-leak at Wuhan or even poor safety conditions.

    This is factually incorrect. You can find this evidence in the House report, and even in a scientific paper by the director of the BSL-4 lab itself.

    On May 15, 2019, Yuan Zhiming, the Director of the BSL-4 lab at the WNBL, submitted an article to the Journal of Biosafety and Biosecurity, entitled “Current status and future challenges of high-level biosafety laboratories in China”.

    https://www.sciencedirect.com/science/article/pii/S2588933819300391#b0080

    Section 3 of the paper is astonishingly frank. Section 3.2 concludes:

    This [regulatory] scenario puts laboratory biosafety at risk since the implementation efficiency and timely operations are relatively compromised.

    Section 3.3 concludes:

    However, the maintenance cost is generally neglected; several high-level BSLs have insufficient operational funds for routine yet vital processes. Due to the limited resources, some BSL-3 laboratories run on extremely minimal operational costs or in some cases none at all.

    Section 3.4 is so troubling that it is worth quoting in full:

    3.4. Deficiency of professional capacity
    In the process of BSL construction, operation, and management, highly skilled professional teams from diverse disciplines such as architectural science, materials science, aerodynamics, automatic controlling, environmental science, microbiology, botany, biosafety, and systems engineering are required. In addition, biosafety measures and practices are vital in daily laboratory operations hence a highly qualified, motivated, and skilled biosafety supervisor is needed not only for overseeing solid containment but also in laboratory risk management. Currently, most laboratories lack specialized biosafety managers and engineers. In such facilities, some of the skilled staff is composed by part-time researchers. This makes it difficult to identify and mitigate potential safety hazards in facility and equipment operation early enough. Nonetheless, biosafety awareness, professional knowledge, and operational skill training still need to be improved among laboratory personnel.

    The House report adds:

    It is important to note that researchers at the WIV had previously conducted gain-of-function research on coronaviruses at the BSL-2 and BSL-3 levels. This is important given that both the head of the China CDC and the head of the WIV’s BSL-4 labs had expressed concern about the safety of this research and the labs in which it was being conducted.

    Lab leaks unfortunately are not uncommon. Even a well-run laboratory is subject to human frailty. For example, in August 2007 there was a leak of foot and mouth disease from a drainage pipe connecting two world-class laboratories on the same site in England. The two laboratories had “spent years haggling over who should pay for replacement of the ageing pipework” that leaked the virus. This is exactly the situation that Yuan Zhiming describes in Section 3.3 of his paper, and it is deadly.

    https://www.newscientist.com/article/dn12615-faulty-pipe-blamed-for-uk-foot-and-mouth-outbreak/

    I can only conclude from the evidence available that the WIV was not a well-run laboratory. It is unwise to rule out the possibility, even the likelihood, of a leak from the laboratory.

    Wei Jingsheng and yourself both know how evil the government of your own country can be, and so it is natural for you both to think that the leak of COVID into the wild was a deliberate act of your own government. However, this is not the only possible explanation.

    The NIH, WIV, and the EcoHealth Alliance were collaborating in dangerous and pointless “gain of function” research on coronaviruses, and they are now all acting as if they have something to hide. The WIV has not been forthcoming with evidence. According to Jeffrey Sachs, the NIH and other US agencies have also refused to answer questions about their coronavirus research. Peter Daszak was trusted by the Chinese to “investigate” the WIV, and he lied in his “not a lab leak” Nature article about his conflicts of interest. We even have a (failed) DARPA grant application involving WIV and the EcoHealth Alliance, proposing the insertion of a furin cleavage site into a coronavirus. Both the proposal, and the work funded by the NIH, were parts of a “business as usual” collaborative scientific project, which for political reasons chose to do its US-government-funded work in a foreign laboratory with doubtful safety standards. Then we had a pandemic caused by a virus of exactly the type being investigated by this project, and both lies and stonewalling from all the participants in the research, both Chinese and American. The failure was an international joint effort.

    The Iranian link is clearly suspicious. However, all it needed was one traveller who had high-level contacts in the Iranian government to fly from Wuhan to Iran. Perhaps an Iranian official who was concerned with the BRI, and briefed Iranian government members on his return from China. I have no evidence for this, but equally you have no evidence that the US government deliberately exposed Iran to COVID. Which scenario is more likely?

    While searching for relevant information, I found a couple of interesting things:

    1. The website that broke the news of the 2018 DARPA proposal is https://drasticresearch.org/ and it is now suppressed in Google rankings. Searches for their scoop put multiple secondary sources above them in the rankings: they were 30th, i.e. bottom of the 3rd page. What is there to hide? Perhaps there is other relevant information on the site that has not been widely reported.

    2. There is chatter about a DARPA report by Joseph Murphy that claims the virus is American-created. I expect you have seen the report. To me the tone of the report, and its lack of security classification, mark it as fake. There is an EU parliamentary question, entitled “COVID-19: made in China, financed by the US” which asks the EU Commission whether the report is genuine. The reply, from the Commissioner for Health and Food Safety, the Cypriot Stella Kyriakides, dodges the question.

    The report:
    https://assets.ctfassets.net/syq3snmxclc9/2mVob3c1aDd8CNvVnyei6n/95af7dbfd2958d4c2b8494048b4889b5/JAG_Docs_pt1_Og_WATERMARK_OVER_Redacted.pdf

    EU parliamentary question:
    https://www.europarl.europa.eu/doceo/document/E-9-2022-000179_EN.html

    • Replies: @Ron Unz
  445. @Wizard of Oz

    The Atlantic Council is NATO. The author once worked for the CIA, formerly NATO Chief (dis)Information Officer in Kiev and is now employed by Radio Free Europe. You have to be kidding Wizz. Who are you signalling your exemplary stupidity and loyalty to The Empire to?

    • Replies: @Wizard of Oz
  446. @Wizard of Oz

    How typical of a Rightwing class bigot. RSI a ‘fashion’, but only among the oinks, eh Wizz. Ever heard of Carpal Tunnel Syndrome you odious, empathy lacking, compassionless swine?

    • Replies: @Wizard of Oz
  447. @Wizard of Oz

    Good, good-keep up the good work, and make sure it’s Pfizer or Moderna from now on.

  448. Ron Unz says:
    @James N. Kennett

    This is factually incorrect. You can find this evidence in the House report, and even in a scientific paper by the director of the BSL-4 lab itself.

    No. You’ve located a handful of vague, scattered sentences suggesting that safety conditions at the Wuhan lab were sub-optimal. But there’s absolutely ZERO evidence of an actual lab-leak.

    Moreover, as I had previously emphasized, the most credible single Western eyewitness was Danielle Anderson, who was working at the Wuhan lab in that period. Read her Bloomberg interview. She said the safety procedures she saw at that time were outstanding and she was extremely skeptical that any lab-leak had occurred.

    Compare that with the months-long shut-down of Ft. Detrick for major safety violations. I’d say that the evidence of major safety violations and a possible lab-leak at Ft. Detrick is probably 100x greater than at the Wuhan lab.

    The Iranian link is clearly suspicious. However, all it needed was one traveller who had high-level contacts in the Iranian government to fly from Wuhan to Iran. Perhaps an Iranian official who was concerned with the BRI, and briefed Iranian government members on his return from China.

    Look, anything’s possible. But it seems extraordinarily suspicious that the two countries in the world first hit with major Covid outbreaks would happen to be the two countries regarded as America’s greatest adversaries, with the Iranian political elites hit just after America had assassinated Iran’s top military commander.

    Iran has one of the smallest Chinese populations in the world, with virtually none of the Chinese living in Qom. If expert epidemiologists had been told that a Covid-like infection began in Wuhan and asked where they would expect it to spread next, Qom probably would have been at the absolute bottom of their list of world cities.

    There is chatter about a DARPA report by Joseph Murphy that claims the virus is American-created. I expect you have seen the report.

    No, I haven’t read it and I have no intention of doing so. Faking documents on these sorts of issues is the easiest thing in the world, and anyone who gives them any credence is a fool. I’d only take something like that seriously if several noted Intelligence experts carefully reviewed it and declared that it was likely genuine. Otherwise, I don’t waste my time on such nonsense.

    The website that broke the news of the 2018 DARPA proposal is https://drasticresearch.org/ and it is now suppressed in Google rankings. Searches for their scoop put multiple secondary sources above them in the rankings: they were 30th, i.e. bottom of the 3rd page. What is there to hide?

    You’re extremely naive. Consider this website. For more than six years, we published ultra-ultra-controversial articles on WWII, the Holocaust, racial issues, Israel/Zionism, the JFK Assassination, the USS Liberty, the 9/11 attacks, and every other extremely controversial matter. I’d say that taken as a whole, my American Pravda series might be about the most controversial collection of material existing anywhere on the Internet. And during all those years we never once had any problems with Facebook or Google.

    https://www.unz.com/page/american-pravda-series/

    The ADL is probably the most widely feared organization in America, and plays a central role in Internet censorship. Here’s a column I wrote about them in October 2018, and for the 18 months that followed we had absolutely no problems:

    https://www.unz.com/runz/american-pravda-the-adl-in-american-society/

    But then in April 2020 I published my article suggesting that the Covid outbreak was probably due to an American biowarfare attack against China (and Iran), and within days our entire website was banned by Facebook and all our pages totally deranked by Google. That seems an extremely suspicious coincidence to me.

    https://www.unz.com/announcement/record-breaking-traffic-despite-our-purge-from-google-and-facebook/

    For ten years some of my own articles had been ranked #1 or #2 out of 150 million results returned by Google searches, and suddenly they all totally disappeared. I’ve been bitterly complaining about that for more than two years.

    The NIH, WIV, and the EcoHealth Alliance were collaborating in dangerous and pointless “gain of function” research on coronaviruses, and they are now all acting as if they have something to hide.

    You’ve completely missed the key point. Daszak’s EcoHealth Alliance was Pentagon-funded and Prof. Sachs has suggested it was an Intelligence operation, using its lure of grant-funding to keep tabs on the Wuhan lab and many other biolabs around the world. How plausible is it that a Pentagon-funded Intelligence operation would play a central role in getting the Chinese to create a very dangerous virus which then—purely coincidentally!—leaked out accidentally into one of their largest cities just before the Lunar New Year travels? (Then it immediately jumped 3,500 miles to hit the Iranian leadership!) If you can believe that story, you’re the most gullible person in the world.

    There’s strong genetic evidence that Covid was bioengineered and that the precursor virus came from the Wuhan lab. Presumably, Daszak or one of his people had obtained it there, and American biowarfare decided to use it as the base for producing Covid so as to throw the suspicion on the Chinese and the Wuhan lab. There’s no need to believe that Daszak himself was aware of any of these plans—he just delivered intelligence reports and viruses to the Pentagon people who were funding him.

  449. g wiltek says:

    Simple test, do same search with Google and Yandex.
    Notice difference.

    Put brain in D.

  450. @Ron Unz

    From your earlier comment, with my emphasis:

    There’s absolutely ZERO evidence of a lab-leak at Wuhan or even poor safety conditions.

    There is no evidence for a lab-leak, but there is significant evidence that the safety procedures were inadequate, as they are in many labs some of the time.

    Moreover, as I had previously emphasized, the most credible single Western eyewitness was Danielle Anderson, who was working at the Wuhan lab in that period. Read her Bloomberg interview. She said the safety procedures she saw at that time were outstanding and she was extremely skeptical that any lab-leak had occurred.

    I’ve read the interview. It is most unlikely that Anderson saw the whole of the lab, especially if parts of it were secretly working on bioweapons. She may be entirely correct in her assessment of the safety of the BSL-4 lab, but this is irrelevant if gain-of-function work was being done at BSL-2 or BSL-3.

    There’s strong genetic evidence that Covid was bioengineered and that the precursor virus came from the Wuhan lab. Presumably, Daszak or one of his people had obtained it there, and American biowarfare decided to use it as the base for producing Covid so as to throw the suspicion on the Chinese and the Wuhan lab. There’s no need to believe that Daszak himself was aware of any of these plans—he just delivered intelligence reports and viruses to the Pentagon people who were funding him.

    I agree with the first sentence. However, even if the US was responsible for the pandemic, I would guess that they would try to keep the activity within Wuhan for the sake of plausible denial. Given the apparent foreknowledge of poor safety (State Department memos of 2018), the simplest approach would be simply to fund dangerous work at Wuhan and wait for them to make a mistake. At a higher level of involvement, an American co-worker from one of the US agencies might cause a lab accident in Wuhan without detection. Doing the dangerous work in the US would have involved several people and would have run the risk that an employee or contractor would have pangs of conscience and tell what they know.

  451. @mulga mumblebrain

    Inalmost used the Carpal Tunne from l Syndrome description but preferred to save tim. If I had intended a serious discussion I would have noted that I wondered in tec80s if the syndrome, real or imagined, had something to do with the switch to computer keyboards from manual.

  452. @mulga mumblebrain

    So the source was so bracing for you that it sapped all your energy and you couldn’t muster a reply.

    • Replies: @mulga mumblebrain
  453. Ron Unz says:
    @James N. Kennett

    There is no evidence for a lab-leak, but there is significant evidence that the safety procedures were inadequate, as they are in many labs some of the time.

    Given your arguments about alleged safety violations at Wuhan, here’s a link to a comment on a different thread regurgitated some of the pro-China propaganda about Covid having leaked out of Ft. Detrick:

    https://www.unz.com/runz/the-wicked-flee-when-no-man-pursueth/?showcomments#comment-5555775

    Personally, I think the Ft. Detrick lab-leak scenario is nonsense and I’ve been arguing for years with all the many commenters who advocate it. But they certainly have far, far stronger evidence of poor safety conditions and a likely leak there than anyone can collect for the Wuhan lab.

    Maybe you should jump over to that other thread and argue with them since I’m sick of doing so myself.

  454. We won the internet war. It’s over. They got their as*es kicked epic. The truth is out there and will incubate. Only later will people realize how this was the most valuable and unusual front. They never anticipated how many would donate tremendous amounts of time and research to slay the dragon and try to save mankind.

  455. Alfred says:

    This might especially interest residents of Santa Clara County, California. 😊

    I doubt if the beloved NYT will pick up this story.

    Sara Cody is the public health officer for Santa Clara County. She doesn’t know the size of SARS-CoV-2 particle. She believes masks work because she misinterpreted the Bangladesh mask study.

    The Sara Cody deposition transcripts

    • Replies: @geokat62
  456. @Wizard of Oz

    That was my reply-if it looks like a skunk, moves like a skunk and sprays shit-scented piss everywhere, it is likely to be a skunk. And if the Wizz thinks it is good, then it must be an alpha skunk.

  457. @James N. Kennett

    ‘….particularly IF parts of it were secretly working on bioweapons’. So your plainly racist imaginings become assertions of fact, through simple projection of US behaviour, without a skerrick of evidence. You should work for Murdoch-or do you do so already?

  458. geokat62 says:

    Dr. Paul Offit, one of the world’s most respected vaccine experts, is now officially an anti-vaxxer!
    Welcome to the club, Paul.

    https://stevekirsch.substack.com/p/dr-paul-offit-one-of-the-worlds-most

  459. geokat62 says:
    @Alfred

    Sara Cody is the public health officer for Santa Clara County. She doesn’t know the size of SARS-CoV-2 particle. She believes masks work because she misinterpreted the Bangladesh mask study

    Sara Cody, Sara Cody… where have I heard that name before?

    Oh, yeah, I remember! She was the heroine in one of the articles Ron penned when the covid story first broke.

    A few choice excerpts from The Government Employee Who May Have Saved a Million American Lives:

    Dr. Sarah Cody. That’s the name of a local government employee probably unknown to almost everyone reading this. Yet I think there’s a good chance that a million or more Americans will owe her their lives. And therein lies a tale…

    But then on Monday, March 16th a miracle occurred. With no prior warning or public discussion, Santa Clara County Public Health Officer Dr. Sarah Cody and her counterparts from five other SF Bay Area counties announced that they had issued a “Shelter in Place” order, their somewhat euphemistic term for a full regional lock-down…

    Under a decaying and decadent political system, there is often a dangerous tendency to select public officials based upon ideological factionalism or the blandishments of self-interested lobbies. During normal times, this may lead to the sort of inefficiency and corruption that saps the strength of a society, but during a severe crisis, survival itself may be at risk. Until a couple of weeks ago, I had never even heard of Dr. Sarah Cody, but I am greatly relieved that my local officials are still appointed based upon the highest standards of meritocratic competence. The contrast with America’s national government could not be greater.

    https://www.unz.com/runz/the-government-employee-who-may-have-saved-a-million-american-lives/

    That bolded part didn’t age very well, did it?

  460. This is one of the few information platforms that advocates (and tolerates) the transparent pursuit of truth in all things. Here are a few straightforward thoughts and questions for you, Ron:

    1. What are the sources of hard evidence that support your scientific conclusions regarding the epidemiology and pathogenesis of SARS Cov-2 and Covid-19 disease? What proof do you have that either a natural or bio-engineered synthetic ‘novel’ coronavirus strain even exists?

    2. If every public health authority in the world has admitted that SARS Cov-2 is no more lethal than a common cold virus (99.97 recovery rate), exactly how did the so-called Covid-19 disease “kill 18 million people including more than one million Americans”? By what medical determination were the alleged millions of Covid victims proven to be infected by the disease, if the completely ineffective and fraudulent Polymerase Chain Reaction (PCR) test was the exclusive diagnostic method used worldwide for positive Covid detection?

    3. The experimental, untested, mRNA injections are not vaccines, but gene therapy pharmaceutical drugs that contain a spectrum of DNA-altering and potentially deadly adjuvants including graphene oxide, spike proteins and unknown lipid nanoparticles. Why would any rational person willingly be used as a Big-Pharma lab rat for these deadly drugs to protect them from a benign cold virus?

    4. High-order pattern recognition skills are not required to recognize the connection between the long-planned global Covid pandemic response and the massive mRNA ‘vaccine’ fraud. It’s difficult to comprehend why you refuse to acknowledge this self-evident connection?

    5. Have you taken the time to review the scientific research of Dr. Peter McCullough, Dr. Michael Yeadon, Dr. Simone Gold, Dr. Carrie Madej, Dr. Reiner Fuellmich, Dr. Dolores Cahill, just to name a small fraction of the thousands of courageous medical and scientific humanitarians who have been on the front lines from the beginning in the battle against this global Covid fraud?

    Final thought: Most Americans have no understanding nor interest in personal freedom. It’s an abstract concept for the clovers who will take scraps from the tyrants table in exchange for their compliance (take the jab or else!). Here’s the thing: if you own your body and control the fruits of your labor you are free. If another person or group of people called government controls your body and property, you are a slave. It’s not that difficult to grasp.

  461. geokat62 says:

    Telegram comment posted by Dr Jessica Rose:

    ” the risk/Benefit analysis for these shots is so simple”

    👉@DrJessicaRose

    https://t.me/DrJessicaRose/126

    Click on the bottom link to view the very short video clip.

  462. Wild Man says:
    @Ron Unz

    “How plausible is it that a Pentagon-funded Intelligence operation would play a central role in getting the Chinese to create a very dangerous virus which then—purely coincidentally!—leaked out accidentally into one of their largest cities just before the Lunar New Year travels?(Then it immediately jumped 3,500 miles to hit the Iranian leadership!) If you can believe that story, you’re the most gullible person in the world.

    There’s strong genetic evidence that Covid was bioengineered and that the precursor virus came from the Wuhan lab. Presumably, Daszak or one of his people had obtained it there, and American biowarfare decided to use it as the base for producing Covid so as to throw the suspicion on the Chinese and the Wuhan lab.”

    Some pretty good theorizing in support of the conjecture:

    sars-cov-2 is a faux-west globalist bioweapon unleashed upon all the people of the world by way of using China state-interests, via Dr. Shi, as patsy.

    Good on you.

  463. geokat62 says:

    Telegram comment posted by Dr. Judy Mikovits:

    It’s Clear: “This Was All Planned”

    Dr. Peter McCullough: “It takes a long time to write a patent … When the crisis was announced in the United States, three days later, Moderna announced they have a product! How can they have a product in three days? You can’t invent something in three days. This was planned!”

    Join: @Dr_JudyMikovitss

    https://t.me/dr_judymikovitss/248

    • Replies: @Wizard of Oz
  464. @geokat62

    And you agree with her? If so, why?

    • Replies: @geokat62
  465. geokat62 says:
    @Wizard of Oz

    And you agree with her? If so, why?

    I don’t agree with her, I agree with him, i.e., Dr Peter McCullough. Why? Because he is a renowned cardiologist and a man of integrity – i.e., a man who is prepared to pay a heavy price for speaking the truth.

    btw – did you view the short video clip in which Dr McCullough goes into more detail on why he thinks it was planned? If not,